Busch Lab

ZMP

vtg3

Ensembl ID:
ENSDARG00000016448
ZFIN IDs:
ZDB-GENE-991019-2, ZDB-GENE-991019-2
Description:
Vtg3 protein [Source:UniProtKB/TrEMBL;Acc:Q0P421]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa41779 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14938 Nonsense Available for shipment Available now
sa21846 Nonsense Available for shipment Available now
sa44735 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35022 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9585 Nonsense Available for shipment Available now
sa31815 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41779
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Essential Splice Site 18 1251 2 28
ENSDART00000103418 Essential Splice Site 25 538 2 15
Genomic Location (Zv9):
Chromosome 11 (position 7524547)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7368650
GRCz11 11 7378489
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTAATGTTTTTTCTTTTTCTCCCATTAGCCAGCGAGATGGCAAATTATG[G/A]TATGTAAATGCAATATATATCAATCTCATTACTTATTACTTACCTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Nonsense 321 1251 8 28
ENSDART00000103418 Nonsense 328 538 8 15
Genomic Location (Zv9):
Chromosome 11 (position 7520109)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7364212
GRCz11 11 7374051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCCAACAGATTTTAGATTTAATCAAGCGCCTCGCACAGGCTAATWTATA[T/A]CATGTGGACAGTGARACCAGCACAGAAATTCTGGACCTAATTCAGTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21846
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Nonsense 601 1251 12 28
ENSDART00000103418 None None 538 None 15
Genomic Location (Zv9):
Chromosome 11 (position 7516366)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7360469
GRCz11 11 7370308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCTACTCTCTGCTCAAAGGCTTTGCCAAGTCCCGTACCCCTGATAAT[C/T]AACATCTGTAAGCATGGTGCAAACTACAATGTGCTCTTCTCCTCTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44735
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Essential Splice Site 710 1251 15 28
ENSDART00000103418 None None 538 None 15
Genomic Location (Zv9):
Chromosome 11 (position 7515788)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7359891
GRCz11 11 7369730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCACGAAAGATTTAGGAATCAGCGATTTGGCTTCCATATTGAAAATT[G/A]TGAGCATCTCTGTTTCAGATTTTATTTATGTTTCTTGTCAATCATTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Essential Splice Site 1039 1251 23 28
ENSDART00000103418 None None 538 None 15
Genomic Location (Zv9):
Chromosome 11 (position 7508979)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7353082
GRCz11 11 7362921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTAAAGTGTTACCCATTTTGTTATGTTTTATGTCTCCTTCTTTGTAT[A/T]GGAGACAAGAGATGAGAACACCTCCTGTGAGGAACGCAAAACATCCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Nonsense 1139 1251 25 28
ENSDART00000103418 None None 538 None 15
Genomic Location (Zv9):
Chromosome 11 (position 7507899)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7352002
GRCz11 11 7361841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTAGTTGATTTTTGTCTTTTCAGGCTCATCTCAGATGGGGTGCAGAGTG[T/A]CAAACATATGAKGTTTCTATGAGAGTGTCCGCAGCGTGCCAACCAGAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27731
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Nonsense 1166 1251 25 28
ENSDART00000103418 None None 538 None 15
Genomic Location (Zv9):
Chromosome 11 (position 7507818)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7351921
GRCz11 11 7361760
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGCGTGCCAACCAGAGTCCAAACCATCTATAAGCACAAAGATTAACTG[G/A]GGGACTCTGCCCTCAGTATTCACAACAGTTGGTCAAATGTAAATTCATTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7660
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Missense 1172 1251 25 28
ENSDART00000103418 Essential Splice Site 459 538 12 15
Genomic Location (Zv9):
Chromosome 11 (position 7507802)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7351905
GRCz11 11 7361744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCCAAACCATCTATAAGCACAAAGATTAACTGGGGGACTCTGCCCTCA[G/A]TATTCACAACAGTTGGTCAAATGTAAATTCATTATCAATTTGAATTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31815
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014979 Essential Splice Site None 1251 27 28
ENSDART00000103418 Essential Splice Site None 538 14 15
Genomic Location (Zv9):
Chromosome 11 (position 7506032)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 7350135
GRCz11 11 7359974
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAACTTTTGGGGATCGAAGCTGCAAATCTCACCATGTCAACTTAACAGG[T/C]TAATTTATGAACTATGGGTTACAAAACTGGTTGTTCCTGTGTACCGACAT
Associated Phenotype:
Not determined