Busch Lab

ZMP

ythdf1

Ensembl ID:
ENSDARG00000016447
ZFIN ID:
ZDB-GENE-040426-2786
Description:
YTH domain family protein 1 [Source:RefSeq peptide;Acc:NP_997878]
Human Orthologue:
YTHDF1
Human Description:
YTH domain family, member 1 [Source:HGNC Symbol;Acc:15867]
Mouse Orthologue:
Ythdf1
Mouse Description:
YTH domain family 1 Gene [Source:MGI Symbol;Acc:MGI:1917431]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13414 Nonsense Available for shipment Available now
sa41192 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27192
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Splice Site, Nonsense 19 614 3 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23960282)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23086100
GRCz11 8 23107339
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTCATTAGAGGTACATCTGATTTAAAATGTTCATTCTTTATTTCAGTG[C/T]AAAATGGCTCTCTTCATCAGAAGGAAACGGTCCACGACAATGACTTTGAA
Long Flanking Sequence:
ACTTGACAGATTTAGGACAATGCACAAGACATCGATGAGCAAATCAAGGCAAAGGCAGGAGCAGCTCTACTAGTGTATTCAGTATTGAGCTCCAGTGTGTTATAAATGGGGTTGTTTTTTACTATAATGTTTTGAAATCAACTTTTTCTAGTTGTTTTTAAATAATAAACAAATAAATGAGCAAATTGAATGTAAAATGGTTTGACATATTTAACTTCGGCCTCCAACGCTCAATCAAGTTTCATTTTTGGCCCTTTATATGAAAAAGTTTGGGCAGCCCTAGTCTATAGTACTGTGATCAGGCAGAACCTTTTTTTAAATGAGTGTTATGTAATTGTACAAAATTTGTTGAAGATCTAAAATGTCACTAGCATAGCATTGTTTCATTCTTTCAAGATATAGCTTAAAGGCTTTTGGATGTAGTTTGGGCTTTGGGTTTAATATCAGATCTAGTCATTAGAGGTACATCTGATTTAAAATGTTCATTCTTTATTTCAGTG[C/T]AAAATGGCTCTCTTCATCAGAAGGAAACGGTCCACGACAATGACTTTGAACCATACCTCACTGGCCAGTCTAATCCGGTGAGAAATGTGTGTTTTTGTGTTTGTCTTTGAATAGGGCTCTGTTAAATTGATCTTGACATTGCAGTGTTTTGCTTTTCTCTGCATGGAAAATTAAAATAACATGATAATAACGATGGCTTATAAATTGCTAAAGATTTAAGAGCAGTAGGACTTTAGTGCTGTTAAAGTTTACTCTGTTCATGAAGTTCAAACAAAACGGGTTATTAACGTACTACTTTGTTTAATCTTTGTTTAATCTGTTTAATCTACTTTGTTTAATTAATAAATAATTATTTTATGTACAGTGCTCAGCATATAGGAGTACACCCCATTTTGAAAATGAAAATTTTTATCCATTTCTTAGTGAATATGGGTAATATATATTGGTGCATTTGAACAAAACAGATTTGTTAAACAGATATATTTATTTTAGCTATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Nonsense 309 614 4 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23962681)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23088499
GRCz11 8 23109738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCATTGCCACCYMACCACCACCACCAGCAGCAGCCTCMCCTCCACTCC[C/T]AGGGTCACCTTCCACCTCACCCTCATGGACTGCCACCCCCACCTCAGCCC
Long Flanking Sequence:
CTCAGAGTTCTGCATATGGGGGCAGCTACAGTTACCCGCCCAGTTCTTTAGGTGGAACCCTGGTGCCAGACGGGCAAACAGGCTTCCCTAGTGACACCCTGAATAAGGCACCAGGTATGAATAGCTTGGAGCAGGGCATGGTGGGGCTGAAGATCGGTGGTGATGTGACTGGAGGTGGTTCCGGAGTTAAGACGGTGGGCTCCGTGATTGGAGGAGGGCCGGTGGCTGCGGCGGTGGCCACGGGTAATGGTGGGACTCCTATTGGACTGCCGCCCCCTAAGCCCACATCTTGGGCAGCCATTGCTAGCAAACCGGCCAAGCCTCAGCAACTGAAGGTGAAGAGTAAGCCAGGGATGCCCATGGCTGGAGGCACCCTGCCTCCGCCGCCCATCAAACACAACATGGACATTGGCACTTGGGATAATAAGGGGCCTGTGACCAAAGTGGCATCATCATTGCCACCTCACCACCACCACCAGCAGCAGCCTCCCCTCCACTCC[C/T]AGGGTCACCTTCCACCTCACCCTCATGGACTGCCACCCCCACCTCAGCCCCCAATGCCGTCTGCACAATCACTTGCCCAGCAGATGGCCATGCAGGGCCCACCCCCTCCGCAGCCTTACCAGAACCACGCCCCTGCTCCTCCCCCGCAAACTCGGTGGGTTGCCCCACGCAATCGCAACCCTGGTTATGGTGGTGGAGGAAGCGTGGACAGCAGTGGCTCCTCGAGTGGTGGAGGGGTCGGCAATGGAGGCGGAGGTGGCCCACCGGGCTCCGGCGCCATCGAGTCCCATCCCGTCTTAGAAAAGCTGCGTGCGGCACACAGCTACAACCCCAAGGAGTTCGATTGGAACCTGAAAAATGGCCGGGTGTTCATCATTAAGAGCTACTCTGAGGACGACATCCATCGCTCCATCAAGTACTCCATCTGGTGCAGCACGGAACATGGAAACAAGCGGCTGGATTCTGCGTTTCGTGCCATCAACGGCAAAGGTCCTGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Nonsense 540 614 4 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23963374)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23089192
GRCz11 8 23110431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTGCCCAACAGTCAGCTCAGGCACATCCGCCTGGAGAACAATGACAAC[A/T]AGCCCGTGACCAACTCGCGTGACACACAGGAGGTGCCTCTGGAAAAGGCC
Long Flanking Sequence:
GTGGAGGAAGCGTGGACAGCAGTGGCTCCTCGAGTGGTGGAGGGGTCGGCAATGGAGGCGGAGGTGGCCCACCGGGCTCCGGCGCCATCGAGTCCCATCCCGTCTTAGAAAAGCTGCGTGCGGCACACAGCTACAACCCCAAGGAGTTCGATTGGAACCTGAAAAATGGCCGGGTGTTCATCATTAAGAGCTACTCTGAGGACGACATCCATCGCTCCATCAAGTACTCCATCTGGTGCAGCACGGAACATGGAAACAAGCGGCTGGATTCTGCGTTTCGTGCCATCAACGGCAAAGGTCCTGTCTACCTGCTGTTCAGCGTCAACGGCAGCGGACACTTCTGTGGCGTGGCGGAGATGCGTTCGCCTGTTGACTACGGCACCAGTGCCGGTGTTTGGGCGCAGGACAAGTGGAAGGGCAAATTTGATGTGGACTGGCTGTTTGTTAAAGACGTGCCCAACAGTCAGCTCAGGCACATCCGCCTGGAGAACAATGACAAC[A/T]AGCCCGTGACCAACTCGCGTGACACACAGGAGGTGCCTCTGGAAAAGGCCAAGCAGGTGCTGAAGATCATCGCTACCTACAAACACACAACCTCCATCTTCGATGACTTCTCACATTACGAGAAACGGCAGGAGGAGGAAGAGGTGGTAAGAAAGGTATTTTGCATGCAACGGTCTGTTCTGCTGATCTTCATTGCATTGTTGAAGCTTATGTGAAATCAACATTAACAATGTTTGTTTTGCTAGCATACATTATTATGCTTTATGTGAACAGTTAATCCGTGCAAGTTCATCTTCAAAGTCTGACCATTTGCTTCTGTCTTTGGACTAGCAGTCCTACACTGTTAGGATCACTCTTTACTAGGGCTGGGCGAAAAATTGATTTTATGAATTAACTTGAATGTGCAGTTTACATCGAGTTGTTGAAATGAAATCAGTTATCACTCTAGCTCATTCAACCCTCTCCTTTGGGTTTTCAGAGTTCCCCGTCAGTTTGCCATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27193
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025171 Essential Splice Site 591 614 4 6

The following transcripts of ENSDARG00000016447 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23963531)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23089349
GRCz11 8 23110588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCTCACATTACGAGAAACGGCAGGAGGAGGAAGAGGTGGTAAGAAAGG[T/G]ATTTTGCATGCAACGGTCTGTTCTGCTGATCTTCATTGCATTGTTGAAGC
Long Flanking Sequence:
CCTGAAAAATGGCCGGGTGTTCATCATTAAGAGCTACTCTGAGGACGACATCCATCGCTCCATCAAGTACTCCATCTGGTGCAGCACGGAACATGGAAACAAGCGGCTGGATTCTGCGTTTCGTGCCATCAACGGCAAAGGTCCTGTCTACCTGCTGTTCAGCGTCAACGGCAGCGGACACTTCTGTGGCGTGGCGGAGATGCGTTCGCCTGTTGACTACGGCACCAGTGCCGGTGTTTGGGCGCAGGACAAGTGGAAGGGCAAATTTGATGTGGACTGGCTGTTTGTTAAAGACGTGCCCAACAGTCAGCTCAGGCACATCCGCCTGGAGAACAATGACAACAAGCCCGTGACCAACTCGCGTGACACACAGGAGGTGCCTCTGGAAAAGGCCAAGCAGGTGCTGAAGATCATCGCTACCTACAAACACACAACCTCCATCTTCGATGACTTCTCACATTACGAGAAACGGCAGGAGGAGGAAGAGGTGGTAAGAAAGG[T/G]ATTTTGCATGCAACGGTCTGTTCTGCTGATCTTCATTGCATTGTTGAAGCTTATGTGAAATCAACATTAACAATGTTTGTTTTGCTAGCATACATTATTATGCTTTATGTGAACAGTTAATCCGTGCAAGTTCATCTTCAAAGTCTGACCATTTGCTTCTGTCTTTGGACTAGCAGTCCTACACTGTTAGGATCACTCTTTACTAGGGCTGGGCGAAAAATTGATTTTATGAATTAACTTGAATGTGCAGTTTACATCGAGTTGTTGAAATGAAATCAGTTATCACTCTAGCTCATTCAACCCTCTCCTTTGGGTTTTCAGAGTTCCCCGTCAGTTTGCCATAAGAACACATTAACAACATGGCAGCGAGTAGGGAAGGACTTGGAGATATATTTCACTCTATGAAATGAAAAAGTATATGGCAATACAAGCACACCTGCCTAAAAATGGCATTATTCAGGGCTCTGTCTTGCATTCACTATGAAACACAGACCTTTGAA
Associated Phenotype:
Not determined