Busch Lab

ZMP

si:ch211-69k21.2

Ensembl ID:
ENSDARG00000016439
ZFIN ID:
ZDB-GENE-091116-69
Human Orthologue:
SLC7A1
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a1
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene [Source:MGI Symb

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9642 Nonsense Available for shipment Available now
sa38799 Nonsense Mutation detected in F1 DNA Not yet available
sa21734 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9642
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 27 610 1 11
ENSDART00000146370 Nonsense 27 652 2 12
Genomic Location (Zv9):
Chromosome 10 (position 24900196)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24499548
GRCz11 10 24469000
KASP Assay ID:
2260-3236.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAACAGCTGCTGAGAGTAAAGGTTGTAAACTGCAACTCAGAGGAATCR[C/T]GACTGTCCCGATGTCTGAACACTTTTGACCTGGTGGCTCTTGGTGTGGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38799
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 96 610 1 11
ENSDART00000146370 Nonsense 96 652 2 12
Genomic Location (Zv9):
Chromosome 10 (position 24900404)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24499756
GRCz11 10 24469208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTGGTCTCTGTTATGCAGAGTTTGGAGCCAGAGTGCCCAAAACAGGAT[C/A]AGCGTACCTGTACAGCTACGTGACTGTAGGAGAGCTGTGGGCCTTTATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4372
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 121 610 1 11
ENSDART00000146370 Nonsense 121 652 2 12
Genomic Location (Zv9):
Chromosome 10 (position 24900480)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24499832
GRCz11 10 24469284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAGGAGAGCTGTGGGCCTTTATAACTGGCTGGAACCTGATTCTTTCATA[T/A]GTTATAGGTGAGAAGATGTWYAATATTGCTATTGRGTTTCCACTAAAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27607
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Nonsense 138 610 2 11
ENSDART00000146370 Nonsense 138 652 3 12
Genomic Location (Zv9):
Chromosome 10 (position 24902057)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24501409
GRCz11 10 24470861
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCTGAGGTACCTCAAGTGTTGCCCGAGCTTGGAGTGCCACATTTGAT[G/T]AGTTGATTGGAAAACATATTGAGCATTTCTGCCGCCAGTACATGTCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21734
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008248 Essential Splice Site 493 610 8 11
ENSDART00000146370 Essential Splice Site 503 652 9 12
Genomic Location (Zv9):
Chromosome 10 (position 24919606)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24518958
GRCz11 10 24488410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCCAACCTGTCTGGATTCACCGTTAACATCTGCACCAGTCTGCTCGG[T/A]ATGAAATATTCAAGACAAACACTGCAAACAAAAATAAGTAATTAATAGAT
Associated Phenotype:
Not determined