Busch Lab

ZMP

fignl1

Ensembl ID:
ENSDARG00000016427
ZFIN ID:
ZDB-GENE-030131-1862
Description:
fidgetin-like protein 1 [Source:RefSeq peptide;Acc:NP_001122223]
Human Orthologue:
FIGNL1
Human Description:
fidgetin-like 1 [Source:HGNC Symbol;Acc:13286]
Mouse Orthologue:
Fignl1
Mouse Description:
fidgetin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1890648]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22254 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22254
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016294 Nonsense 184 661 1 1
ENSDART00000131390 Nonsense 184 661 2 2
Genomic Location (Zv9):
Chromosome 13 (position 15896393)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15811426
GRCz11 13 15942418
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTTTACCCACAGCGGAAATGGCAAGGGGGGACATTAACCCAATTAGT[G/T]GATCTGGGGGACTCGAAGTAGCCCCTCCGCGTTTTTCCCTAGCACAAAAT
Associated Phenotype:
Not determined