Busch Lab

ZMP

her8a

Ensembl ID:
ENSDARG00000016363
ZFIN ID:
ZDB-GENE-030131-2376
Description:
hairy-related 8a [Source:RefSeq peptide;Acc:NP_955918]
Human Orthologue:
HES6
Human Description:
hairy and enhancer of split 6 (Drosophila) [Source:HGNC Symbol;Acc:18254]
Mouse Orthologue:
Hes6
Mouse Description:
hairy and enhancer of split 6 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1859852]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34072 Nonsense Mutation detected in F1 DNA Not yet available
sa40894 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019035 Nonsense 20 221 1 5
ENSDART00000123395 Nonsense 52 253 1 4
Genomic Location (Zv9):
Chromosome 7 (position 27562197)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26165136
GRCz11 7 26436329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCAACATGGGCAATGGTCCGGAGAAGAATTTCAACGCAAAAGAGGAG[C/T]GAAAGGTAATGTCACATTTGCGGCATTTTGTGCGGTTTGATGATGACTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7064
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019035 Essential Splice Site 53 221 2 5
ENSDART00000123395 Essential Splice Site 85 253 2 4
Genomic Location (Zv9):
Chromosome 7 (position 27560821)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26163760
GRCz11 7 26434953
KASP Assay ID:
554-4875.1 (used for ordering genotyping assays)
KASP Sequence:
CGAGCCTTGAGCAGCTGAAGGGTATAATGGTGGATGCCTACAATTTGGAC[G/A]TAAGKGAACTACATGAATAAAYACATTGTATACATACAGTCAAGATCCWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019035 Essential Splice Site 79 221 3 5
ENSDART00000123395 Essential Splice Site 111 253 3 4
Genomic Location (Zv9):
Chromosome 7 (position 27560375)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26163314
GRCz11 7 26434507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGATCACAGTTCAGCACATGGAGAATCTTCAAAGAGGTCATGGACAGG[G/A]TTAGACATTCTGTGCATCATTTCTTTACTTTTCTCACACATATTAAGCTA
Associated Phenotype:
Not determined