Busch Lab

ZMP

fmo5

Ensembl ID:
ENSDARG00000016357
ZFIN ID:
ZDB-GENE-030131-6606
Description:
flavin containing monooxygenase 5 [Source:RefSeq peptide;Acc:NP_944592]
Human Orthologues:
FMO1, FMO2, FMO3, FMO4, FMO5, FMO6P
Human Descriptions:
flavin containing monooxygenase 1 [Source:HGNC Symbol;Acc:3769]
flavin containing monooxygenase 2 (non-functional) [Source:HGNC Symbol;Acc:3770]
flavin containing monooxygenase 3 [Source:HGNC Symbol;Acc:3771]
flavin containing monooxygenase 4 [Source:HGNC Symbol;Acc:3772]
flavin containing monooxygenase 5 [Source:HGNC Symbol;Acc:3773]
flavin containing monooxygenase 6 pseudogene [Source:HGNC Symbol;Acc:24024]
Mouse Orthologues:
Fmo1, Fmo2, Fmo3, Fmo4, Fmo5, Fmo9, Gm4846, Gm4847
Mouse Descriptions:
flavin containing monooxygenase 1 Gene [Source:MGI Symbol;Acc:MGI:1310002]
flavin containing monooxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:1916776]
flavin containing monooxygenase 3 Gene [Source:MGI Symbol;Acc:MGI:1100496]
flavin containing monooxygenase 4 Gene [Source:MGI Symbol;Acc:MGI:2429497]
flavin containing monooxygenase 5 Gene [Source:MGI Symbol;Acc:MGI:1310004]
flavin containing monooxygenase 9 Gene [Source:MGI Symbol;Acc:MGI:3606068]
predicted gene 4846 Gene [Source:MGI Symbol;Acc:MGI:3643319]
predicted gene 4847 Gene [Source:MGI Symbol;Acc:MGI:3643320]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17238 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17238
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034011 Essential Splice Site 395 560 7 9

The following transcripts of ENSDARG00000016357 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 15102331)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15196967
GRCz11 20 15096470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCCCATCTCTGAGATGCAAGCRCGYTGGGCCACACGTGTTTTTAAAG[G/A]TATCAAACATGATGYTGATACACAGAAAAATACAGAAMGTTTTTAATACR
Long Flanking Sequence:
AGGTACTGTGAATACTGAAGAACAATATTTACATCCCATTGGTTAGTCTCAGTATTTGTACTTTTTCATGATGTTATCTTTTTTATGTTTTATTATCTGCCCTATTCAACATGTATTATATTACGTCTGTTGCTAATTTATCAGGTTTTTCAGCCAACATCCCATGGTCAATGATGATTTGCCAAACCGGATCCTCTCTGGTACTGTCTCAGTCAAGCCCAATGTGCAGGAGTTTCGTGGATCTAGTGTGGTGTTTGAGGATGGCACTGTTGAAGATAACATTGATCTGGTGGTGTTTGCCACAGGCTACACTTTCTCATTCCCCTTCCTTTCCTCACATGTGATCCCTGTTTCAAACAACAAGGTATCCCTGTACAAATTTGTATATCCTCCAGGATTGGAGCGCTCAACTTTAGCAGTGATTGGTCTGATCCAGCCTCTTGGAGCCATTATGCCCATCTCTGAGATGCAAGCGCGCTGGGCCACACGTGTTTTTAAAG[G/A]TATCAAACATGATGTTGATACACAGAAAAATACAGAAAGTTTTTAATACGTTATATGATATATTTCAAGCATATTTAAAATCCTCTACTTGATTTCTGGTTCATAAAAAGCCACTGCTTTAGAAAAATCAGGCCATACCAACTAAGGGAATGCTGAACCAAGAGCCAGCAATAAAATCCTTTGTGCTAGGTTCACACCAAATGCAGAATTAAGTATTCACATGAGTAAGGTTCAAACAAAATCAATGCAACACATGGAATTCAGCTCAATCACGTCACAAGTAAAGGCCAATCATGTTGGCCAATCAGAAAGGAGCATTGGTGTACACACTGACCAAGCGGCAACCTCCCGCTTTCCCTCAGGAAGCCAATACGGAAGTAACTAAAACTGCAATTCATCCAAAATTCCGCTAGTCCTGGCCGCTCTTGGCTTGAGCAAATTTCAATTGAGCCCACTGTTAGAATGGCCAACTTTACAGCAGAAAAAAAGGTGTTTACAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6625
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034011 Nonsense 433 560 9 9

The following transcripts of ENSDARG00000016357 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 15100271)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15194907
GRCz11 20 15094410
KASP Assay ID:
554-5210.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTCATGCAGRTATGTGGTCAGCCAGAGGCACACCATCCAGGTGGACTA[C/A]ATCCCCTACATGGATGAGTTGGCTAAACAAGTGGGTGTCCGTCCTTCTAT
Long Flanking Sequence:
AAATCACTTGGGCCGAAGTTTTCCAAAAGTTTTGGAATCAGTCACCTGATACATGACAGTAAACCTCCAGGCACCCACCAGAGCACCCACCAATGATTTGATTAATTTTCCTAAAAATCACATCAATTTTTTCCTGACTATCTAACTAAGGACGACAATGCTTAAAACATTAGGACGTTATCTTATTTTAAAATATTACACACTGATTATTCAGATTGATTTTGAAGTAATAAAACATGTCAAAGCATTAACTGTATGCAACTCTCATGTTGACCCAGGACTGTGCAAACTGCCTTCAATGAATGCAATGATGAACGACATTAAATCAAAAGAGGAAGCAATGGCTCGAAGGTTCTCTGCACTTCACCTCACATTACTACAAAACACATCACTTTCACAGTTTTAAAAGATAAAATGCGATATCAGTATGATTAATGACTCTTGATTGTGCTCTCATGCAGATATGTGGTCAGCCAGAGGCACACCATCCAGGTGGACTA[C/A]ATCCCCTACATGGATGAGTTGGCTAAACAAGTGGGTGTCCGTCCTTCTATCCCGAGGTTGCTGCTGACAGACCCAAGACTGGCTTTCAAAATCATCTTTGGGCCCTGCACCCCATACCAGTTTCGCTTGCATGGACCAGGCCAGTGGGAAGGTGCACGTCAGGCCATCCTGACTCAGTGGGATCGAGTTATGAAGCCTCTGAAAACACGCTGCAGAGAAGAACCACAGTCACAGAGCTTCTTACATTCACTCATATTCTCAGTGTCTGTTGCAGGGCTCCTGTCTGCTCTGTACTACGGCAGAGCCAGTCTGCAAACATTCTTGGAAAATCCTTCAGCTTTACTGGACAAGATCAGGGGGTTTGTACCATTGCCCACACAGTGATCATGTTATATTAGCCAGAAAAATACTTTACTTCATATGTAATCTAACATCAGTTTAATTGTCCTTATTCAGATTGATTTTAAAGTCAAACAAATGTCAGCATCATGAAAATGACA
Associated Phenotype:
Not determined