Busch Lab

ZMP

LOC568954

Ensembl ID:
ENSDARG00000016348
Human Orthologue:
DIP2B
Human Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) [Source:HGNC Symbol;Acc:29284]
Mouse Orthologue:
Dip2b
Mouse Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145977]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa11944 Essential Splice Site Available for shipment Available now
sa18847 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15891 Nonsense Available for shipment Available now
sa31527 Nonsense Available for shipment Available now
sa38568 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15645 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11944
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 592 1603 14 39
ENSDART00000044276 Essential Splice Site 592 1603 14 39
Genomic Location (Zv9):
Chromosome 6 (position 39492816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39564416
GRCz11 6 39561952
KASP Assay ID:
2259-7857.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTYTGGACTTTAAGAAGGACATGGGATTGTGGCATGGAGTTCTAACGG[T/C]GAGAGGAAATAAATGTGTATAWGTCATCACTGGTAATGCTGAATTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 592 1603 14 39
ENSDART00000044276 Essential Splice Site 592 1603 14 39
Genomic Location (Zv9):
Chromosome 6 (position 39492816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39564416
GRCz11 6 39561952
KASP Assay ID:
2259-7857.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGGACTTTAAGAAGGACATGGGATTGTGGCATGGAGTTCTAACGG[T/C]GAGAGGAAATAAATGTGTATATGTCATCACTGGTAATGCTGAATTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15891
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Nonsense 948 1603 23 39
Genomic Location (Zv9):
Chromosome 6 (position 39484705)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39556305
GRCz11 6 39553841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACATCTCAGACACCAAACAGCTGTTYCTAGAGGGRGCACTACATCCCYG[C/A]AACATTCTCATGTGYCCACACACCTGYGTCACCAAMATGCCCAAACCAYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Nonsense 968 1603 23 39
Genomic Location (Zv9):
Chromosome 6 (position 39484647)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39556247
GRCz11 6 39553783
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGTGCCCACACACCTGCGTCACCAACATGCCCAAACCACGCCAGAAA[C/T]AACCAGGTGTGTTTTTTAAACCATAAATCTGCTTTTACATACACAGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38568
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 1083 1603 27 39
Genomic Location (Zv9):
Chromosome 6 (position 39482703)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39554303
GRCz11 6 39551839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAGTGGCATTAACATCGGAGAAAATGTGGTGCTTTTGTATCCTCCAG[G/A]TAAACAACACTCCTTTAACAATGCGTATAATGAAGGGCTATAAACAGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26789
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Nonsense 1226 1603 31 39
Genomic Location (Zv9):
Chromosome 6 (position 39476777)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39548377
GRCz11 6 39545913
KASP Assay ID:
2259-7855.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATAAAGCTGCAGTGTGAGCTCTACTCCTCTCGCCAGATCGCCATCTG[C/A]CTTGACCCCTACTGCGGACTTGGTTTTGTGCTCTGGTGCCTTGCAAGGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26788
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 1420 1603 36 39
Genomic Location (Zv9):
Chromosome 6 (position 39471367)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39542967
GRCz11 6 39540503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCAATCCAGAAACTAGAGGACCGCTAGGGGACTCTCACCTGGGGGAGG[T/C]GCGTTGACATATGAGATCTGTCTGTCTGTCATTCTATCTTATTTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15645
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044276 Essential Splice Site 1520 1603 38 39
Genomic Location (Zv9):
Chromosome 6 (position 39463149)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39534749
GRCz11 6 39532285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGACATCGAGACCAGTGTGTCTCGTGCCCACCGCAGCATTGGTGAAAGG[T/A]AACTTTGCTTTAAGAGGGCCACATTATGCTTTCTGTACTAGTTAAACTTT
Associated Phenotype:
Not determined