Busch Lab

ZMP

stab1

Ensembl ID:
ENSDARG00000016311
ZFIN ID:
ZDB-GENE-090916-2
Human Orthologue:
DOCK9
Human Description:
dedicator of cytokinesis 9 [Source:HGNC Symbol;Acc:14132]
Mouse Orthologue:
Dock9
Mouse Description:
dedicator of cytokinesis 9 Gene [Source:MGI Symbol;Acc:MGI:106321]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa33829 Essential Splice Site Available for shipment Available now
sa26704 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20666 Nonsense Available for shipment Available now
sa33828 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10789 Nonsense Available for shipment Available now
sa20665 Nonsense Available for shipment Available now
sa15473 Essential Splice Site Available for shipment Available now
sa26700 Nonsense Mutation detected in F1 DNA Not yet available
sa13975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33829
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 38 2074 1 53
Genomic Location (Zv9):
Chromosome 6 (position 12634165)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12487387
GRCz11 6 12722245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTCTTGGGGAGATGGAGGTGGATGGGGACACAGCAATGCCTGTTGGGG[T/G]GAGTCTCTTATGTGGACATAAAAAAAAACAAAAAAACATGTTTAGTATGT
Long Flanking Sequence:
GGTGAAACAGACAGTTAAGATCTCTGTTTCAGCGCAGAGGGAGGACAGATGAGCGTGACATAACACAATAGTGGACACACACACACACACACACACACATACACATGCACTCCCCCATACCAGAACAGCTGTGTGAAGGAGTGGTCTCTGCTTCTCCCATGCAGGGAAAAAAAAGAGAGCGAGGGAGGGACTGAAGTGATAGAGGAAAACACTCTTGAAAACTCCACATGGTAAAGTTCAGCTTCAGAGAGAGAGAAAAGTGGAAGAACAGAAGGAGTGCAGGAGAAGTGTGCAGTGCTGTTTGTTCAGTCCTAGCCTGGGTTTTATTTCTGTGCCTGTCGTTGATTTGAGTTGGGTTTTCTGGAGGGATTGTGTGTGGTGGATCATGCAGGGCAAGGCTGGACGAGCCGCCCGTAAGGATGCAGTGTGTGAAACACCTCAGCAGGGCAGGACTCTTGGGGAGATGGAGGTGGATGGGGACACAGCAATGCCTGTTGGGG[T/G]GAGTCTCTTATGTGGACATAAAAAAAAACAAAAAAACATGTTTAGTATGTCTGTGGTTGTTGAGGCTAGACTTAAAAGTTAGACTGTCAGAAAAATAACAATTTGTATTGTTAGGCAGTGCCTGTACTTTTGTCTTAAAAAGTGCATTTTAGTAGCTTGGAGAAGTAATATGTAGCCTTAAGGTACTGTTGCAAACTTTTATGGGCAAATAAGGTACAAAGATCATCAATTCTGACATTTTTTTCAAGGATTACTAAACTTCTTCTTTATGACAGTTACACAGAATAGTCAATTCAATTTAAATATGAAATGTAAGACTAAAACTACACAAAGAAAAAAAAGAAATGATATATTAACAGAATAAAGTTTAGATTCAAATTAAGATTAAATGCAACAGGTTTATTTTACTGCCTTAGTAATATTTTAGTTTTATTAATTGTTTAAATTAGTTGTATTTTTCTCTTAATATATCTCTTTTTTCTCTTTTATATATTTTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 77 2074 2 53
Genomic Location (Zv9):
Chromosome 6 (position 12625822)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12479044
GRCz11 6 12713902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCGATGTCCTCAGAGACATGCTTCAGTTTCCCATCGATGACTTCCAG[G/A]TAGGAACGTCAGTTCATCTCTCAAACCATCTGCTCTCCCATCAGTCTTCA
Long Flanking Sequence:
TGGAAGGATTCAGCCTTTAACTAAGCAGTAGATCTGCATAAATTATAATTACTTACAAGCAAAAATAAATTAATAAACAGCGCTTATTGGTTTTCTGCAGACTCTAACAGTATTTAAGAAGAGAAATTGAACAATCAAACGTTAAATAACATGGTCATCATTGTATAAATAATTTTTTAAAATAATATATTTAATTGTATCTTTATCTTTTAATCTTTAATATACAATTTAATAATGCGATGTGACTTTTGCAGACCCACACATTGCAATATCGATGCTTAAATCATATATTGTCCTAATTTAAAGTCCTGAAAATATCATTATTTCTTCTAGTTTGCTCTTGTTAAACTTAAGCACATGTATGCTTGTGTGTTTGTCTCCAGGTGAAACCCAAAGTGATTGAGCCGCTGGACTACGAGAATGTTCTCGTCCAGAGGAAAACTCAGATACTCAGCGATGTCCTCAGAGACATGCTTCAGTTTCCCATCGATGACTTCCAG[G/A]TAGGAACGTCAGTTCATCTCTCAAACCATCTGCTCTCCCATCAGTCTTCATTCCTCCATTCCTCCTTCTCATTCCTGTCATTGTTTTCTGTTCTCTTCTTGTCACACCCACACTGCGATTTCCTCTAAAGTGTTATTTTTTCAGCGTGATTCTGAGAGCTGAATGATGAGTAACCTGTGCAGATGTGAGTTTTCTCAGTCTCTCAGTGGCTCGTCTTAGGTTTGCTTCCTCCCTGGGCTCACTAGTCAAACATCTCTCGTCTTCCCTCAAATAGCATTAGAGTAACAGTGTCTCAGGGGATCTCTCGAACTGCTTCCCTGAATGAAACCGTCTCGTTGTTTTCCTTTAGAAATGGGTGTGTATGCTGGAGATTATTGTTATGGGATGTGGTTTATGGGGAACAGAAACATGAAAACTGTGTTGTGCAAACAGCTGCCTGCTTAGCCGAAACCAAACATTCGTAACTCAATTATAAGATTAGTGTTCGGAAATTAGACTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26703
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 135 2074 5 53
Genomic Location (Zv9):
Chromosome 6 (position 12613381)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12466603
GRCz11 6 12701461
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGCTATTGCGAACTTTATGTCTTGTTTTATGTCTTGTTTCTTTTACA[G/A]TAAAGTTCCTCGGCCAGAGAAGCTCGCTAGTCACGTGTTTGAGGTGGACG
Long Flanking Sequence:
GGTCAATAACCTGCAAATCAAATTGTGGAGATCAGGAGGAAGATAGTGTAGCATTTGGTAAAGGTTGCAGAGGAAGCATATTCTGATGGAGGCAGAGATAATGTGTGCTGTGGTTATGCAGCTTCACCATCATCATCATCATCATCATCATCATCCGTCTATACTCCTTTATAATAGTTTCACTAATGCAGTTTCCTTGAGCTGACATACTGTACAGTGCACTCGCACATGCACATGAGCTTTGCAACAGCTGTGTGAGTGATAAGTGCAACAGTGCCCTTGACTTACAGTCACATACACATAGTAAGTGCTTCAGACATAAATGACGCCTCAAATAGTTTAGCTCATTGATGGGATGTTTTTCATTTAATGTAGCAACCACATAATCATAAACTGAAAACAGTCAGAGCATTTTAGGTAATGCTAGTTACACCACTACAATTAGACTTAATATGCTATTGCGAACTTTATGTCTTGTTTTATGTCTTGTTTCTTTTACA[G/A]TAAAGTTCCTCGGCCAGAGAAGCTCGCTAGTCACGTGTTTGAGGTGGACGAGGATGCAGATAAGGAGGAGGTAAGGCACAAATACCCATTATAGTTTTCTGTGATTCCTGGAAAAAACATTTGACTTGGAAATGGGTGTTATTTAAATAGTGTGAGTACATTTAAAAAATAAAAATGCTGTTATTAATTACTCACCTTTTTTAAGTTATTAATTACTCATTAATTACTAGTTACCTGTCCTTTCAGTCCTATGAGTTCTTTATTCATCTTCTAAACACAAATTAAGATATTTTAGGGGAAATTCAAGTGCACACTGACCCTCGTTAGACAACAATAGTTCCGAGACAAATCCAGAAAAGGAACCAAAAACATTCCTTGTGACTTCAAATGATGTGTATTTTGATTGTTTACATACAAAGTTTTAATTTTCATTCACATATTTAAATTTCTGTGTTAGGGGTGCACACATTTTTTATGTAAAATTTGCCATCATTTTTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26702
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 652 2074 17 53
Genomic Location (Zv9):
Chromosome 6 (position 12590497)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12443719
GRCz11 6 12678577
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCTATCCCAAACACCTCAAATATGACAACCAGAAGTCCTTCGCCAAGG[T/A]ACATTAGCATTATCTATATCTATATAGCTCGTCAAAACTGCACTTACAGA
Long Flanking Sequence:
ATATGGTGATGCCCATAACAAATTTTCTTTCAAGGACAATAAATTTTACTACAGCTAGATAGAATAGATATTGATGTGGCCTATGTCGAATCTGTGTCCACAGACCTGAGAAGATGGCTAAACTACCTGTCATCCTGGGAAACCTGGATGTGACTATTGATAATGTTCCTCCTGATATGGCTAGTACGTCTTTAAAATAATTGTTAATGTCAAGCTAGTCTATAATCCACTTCTTGTTTTTAACCCTAATTTGTTATATACTGTATGCTCTTTGCTCATTGGTCACTTTTCTCATTGCTATTGGCTAGATTGTGTAACTCCATCCTACATCCCAGTGAGGCCTTTTGAGAGCAATGGGCCCAATGATGGTGTCCTGTTGGAGGTGGAGGAGTTTGTTCCTTGTATCGCCAAGTGCTCTCAGCCTTTTACCACCTACAACAATCATCTCTACGTCTATCCCAAACACCTCAAATATGACAACCAGAAGTCCTTCGCCAAGG[T/A]ACATTAGCATTATCTATATCTATATAGCTCGTCAAAACTGCACTTACAGATTCACCAGTATATGTTTTTTTCTGGCTCATATTTTCTTCTCTCTCATGTGACTCAGGCGAGGAATATTGCAGTATGTGTGGAATTCAGAGAGTCGGATGAAGAGGATGCTCAAGCCTTAAAGGTATATTGTTTATTCCAGATATACAGTAGAAGCTATATTTAATATACAAAGTGCTTCTGGCAAGTTCTATTGGAAAACAGAAAACATTTCCCAATATTTTCTGTTCTTTCATATTCTCTACCGTTGAAATCAGAGTAATTTCTTTATATAAATTATGTTGTGTTTGTGTGTTTTTGCTGAATAGTGTATCTATGGTCGTCCAGGAGGGCCTGTCTTTACCAAACATGCCTATGCAGCTGTACTGCACCACCAGCAGAACCCAGAGTTCTATGATGAGGTGATCAAGGGGACACTGGCATACATTTTATATGGGGTGCAGCAGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20666
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Nonsense 675 2074 19 53
Genomic Location (Zv9):
Chromosome 6 (position 12590138)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12443360
GRCz11 6 12678218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTCTTTATATAAATTATGTTGTGTTTGTGTGTTTTTGCTGAATAGTG[T/A]ATCTATGGTCGTCCAGGAGGGCCTGTCTTTACCAAACATGCCTATGCAGC
Long Flanking Sequence:
CCAATGATGGTGTCCTGTTGGAGGTGGAGGAGTTTGTTCCTTGTATCGCCAAGTGCTCTCAGCCTTTTACCACCTACAACAATCATCTCTACGTCTATCCCAAACACCTCAAATATGACAACCAGAAGTCCTTCGCCAAGGTACATTAGCATTATCTATATCTATATAGCTCGTCAAAACTGCACTTACAGATTCACCAGTATATGTTTTTTTCTGGCTCATATTTTCTTCTCTCTCATGTGACTCAGGCGAGGAATATTGCAGTATGTGTGGAATTCAGAGAGTCGGATGAAGAGGATGCTCAAGCCTTAAAGGTATATTGTTTATTCCAGATATACAGTAGAAGCTATATTTAATATACAAAGTGCTTCTGGCAAGTTCTATTGGAAAACAGAAAACATTTCCCAATATTTTCTGTTCTTTCATATTCTCTACCGTTGAAATCAGAGTAATTTCTTTATATAAATTATGTTGTGTTTGTGTGTTTTTGCTGAATAGTG[T/A]ATCTATGGTCGTCCAGGAGGGCCTGTCTTTACCAAACATGCCTATGCAGCTGTACTGCACCACCAGCAGAACCCAGAGTTCTATGATGAGGTGATCAAGGGGACACTGGCATACATTTTATATGGGGTGCAGCAGAAAATAATCATAAGATAAGAAAATGTATACAATATGTATACAGTATACAGTTCGTGACCCTGGACCACAAAACCAGTTTGCATGGGTATATTTTTGGCAAAAGCCAATATTAAATTGTTTTGGTCAAAATCATTGATTTTTATTTAATGCTAAAAAAATGTGAGTAATATGTAAAGGTGTTCCTTGAAGATTTTTCAGAGTACCCGCGGGGTCTTAAAAGCATTGAAAAAGTCTTACATTTGATGATCTCAAATTAAGGCCTTAATAGCCTTGAATTTGGTATACAAAGTCTTGGATTTTGTTACAAAGGTCTTATTTTATTCATTTATTTTTGCTTTCCCTAGGATTAAGTTCATTGTTACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 782 2074 21 53
Genomic Location (Zv9):
Chromosome 6 (position 12587809)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12441031
GRCz11 6 12675889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCAACCTACCAAATGGTTACCTCAGCTGCCAGGAGGGAGTAAGCAAGG[T/C]AAACCTTCTCTGCAGTCATAACAGAAACTTTTTTTGAGATTACAGGCATT
Long Flanking Sequence:
TCCTACATATATTTCGAATGTATTGCTCATGTTTTAGGTATATTTAAGTTCATAAAAAAATGTTATATGTCTTTGTGTATGACCTACAGATAAAAATTGAGTTGCCCACACAGCTACATGAAAAGCATCACCTGCTGTTCACTTTTTACCACATCAGCTGTGACAGTAGCACAAAGAAACGGGACATAGTGGAGACCCCAGGTACGGCATGCTGCATAATTGACTTAATGAACAATAATGAACAATACACAATTGCGGTATGCACTGTGGTTCCAGAAATGCACTTATTTAGAAATTTTATCTGATTATGACTAACGTTTTTGTTGTATAATTAATGAGTGCCATTGGATGAGTTGTGTTTGCATCTGTGTCTCTGTTAGTGGGCTCTGCCTGGCTTCCTCTGCTTAAAGATGGTCGTGTTGTTATGAGTGAGCAGCACATTTCTGTGGCTTCCAACCTACCAAATGGTTACCTCAGCTGCCAGGAGGGAGTAAGCAAGG[T/C]AAACCTTCTCTGCAGTCATAACAGAAACTTTTTTTGAGATTACAGGCATTTGCTGGCCAAATGTGAACCTGCAGTGCACTCTGTCCAGTATTTGGAACCTTATTTCTCTTTGTGTTGCTATTTGGACATCTACAACTTTATGCTAATTTATGCTAGCAACATGTTATTAGCATTCTAATTCTTTCTATCAGCATGTTAATAATGATAAAATATGCTAGCAGAGTGGTAATTCATACTAGAAATAGAGTAATCACATTTATTTGGTATATGGAAACACTGTGCTAATTACATACTCAGAACTTGCTACCAACATGTTAGTAAATGGTAAAACATGTTAGCAACATGATAATTCATACTAGCATCCTGCTAGCAGCATGTCAATTTATGCTAAAACATGTCATAAAGTAAGAAACATAACAGCAAAATCTTTTGCTAGCAAAATGCTAATTTATGGTAAAATATGTTCATTAAAACCTTGCTGAAAAAACAGCTTAAACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Nonsense 1040 2074 29 53
Genomic Location (Zv9):
Chromosome 6 (position 12580321)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12433543
GRCz11 6 12668401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TKCATGGACAGAGGATTTGTCTTCAAGCAGATAAACAATTACATMACCWG[T/A]TTTGTTCCTGGAGATCCTAAGGTACACATRGTGAACTATTTATATTATAG
Long Flanking Sequence:
GATGCTTTTGGGAAACGCAGCCCTTGAAAGTTCCAGCAAAGTATATTGGAGCTAAAATCTACTGTATAATGGCCTTTTAGCAAGAGGATTGAGCACCGCTGTTATTATCTCTTTTGTGTTTTGTAGGAGGTGTTGAATTACTGTAGTACTTTTTAAAGTTCCTTGTGTAATTTGTTCTTGCATGTTTAGCTGTCCAGAAACCAGCGATTCACAGCTTCATTCCATCATGCTGTGGAGACGCTGGTGAACATGCTGATGCCTCACATCACCCAGAAGTACAAGGACAATTTGGACGCTGCCCGCAATGCCAACCACAGCCTGGCTGTCTTCATAAAGGTACATACATAAAGCAGCTGTGAAGTGTCTTGATTTGACTTTCATGCATTTCTTGACCATTTGAATTCATCATTAACAGTGTTTTCTCTCACTGTCTCACAGCGCTGTTTTACCTTCATGGACAGAGGATTTGTCTTCAAGCAGATAAACAATTACATAACCTG[T/A]TTTGTTCCTGGAGATCCTAAGGTACACATGGTGAACTATTTATATTATAGCTATATGAACTGCTTAAATCTTTATCTGTAATTCAGAATCAAGAGCTGTTGTTATTAGCTGTCTCATGCTCAAAAATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAATATAAAATATTAATATAATGAATGAGTGTGAATGAGTGTGAATGGATGATTCCCAGAGATGAGTTGCAGCTGAAAGGGCATCCGCTGAGTGGAACATGTGCTGGATAAGTTGGCGGTTCATTCCGCTGTGGTGACCCCTGATTAATAAAAGAGAATAAGCCGAAAAGAAAATGAATAAATGAATCCTATTAATTAATAATATTCTTTATTTTGTGATTTTTTTTTTTTTTTTTTTGTAAATTTTTTTTGAGTTGATGGAATTTAAAAATGTAAATAAACACCCATGAAACTTCAGAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20665
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Nonsense 1160 2074 32 53
Genomic Location (Zv9):
Chromosome 6 (position 12568408)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12421630
GRCz11 6 12656488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTCAGCAGGCCAGGTTGGCGACGCTTTATCTACCCTTGTTTGGCT[T/A]ACTACAAGAGAACGTTCACAGACTAAATGTGAGAGACGCATCTAATTTTA
Long Flanking Sequence:
TTTCTTTGTTTCTAAAGCTATTGCCTTATACTAAATCTTATACTCTTAATGGATGTAACTATTTAACAAAACCAAATTAATATTATTTAATTTAATAAAACTGCACCAAAATATATTAGTCTATATTCTCTGAGAAATGGATAAAAATATTACTACTGCCAGTACTCATTTAAGCTGAGCACTGTAGCTGTAAAAAAAATAATTTAAATAAGCTCAAGATACAGTGCATTTTAAGTCAACGTAACCTAGTTAAATTTGTATATATTTTGGGTTTGTAGAATCATTTCAAAAACAAAAAACATGTTAAATGACCAGGTAAACAGCACCTATAGTTTTTTTTAGGGAAGAGACTCAAGTTCCCAATCACAGCACAACACAACACAAACAAGCAAAAAAAAGGTGTCATGACAGCAGGTAAATCACTTAATTGTTCTATATGTGCGTGTTTGTGCAGAGTCAGCAGGCCAGGTTGGCGACGCTTTATCTACCCTTGTTTGGCT[T/A]ACTACAAGAGAACGTTCACAGACTAAATGTGAGAGACGCATCTAATTTTAACACCAACCAGGTGAATCGTCTTTATAAACTTTGTTTTCTTCACCAGTGTATCATTCAGACCTTTCACCACACATGCCATCTGAAATGTTAGGTTGAACTCTATTTTTGTTTTCCTCAGAATGGTCGAGATGAACATCTTGCCAGCATCCCTAGCGCTACGCCCCAAAAGCCTGTTGGTAATCTCGACAACAGCCTACATAAAGATGTATTTGGGGTCATCTCAGGAACTGGTGAGTGTTGACGGAATCATAAACACACAGCTCAAGCCTTTCAACCGCTGTTGAGATCTTCAGAAGATGTTTGTGTAAATGATATAGCTTTACTGTGTGTGTAGCCTCTCCTCACACCTCCACGCCAAACATCGGCTCTGTGCGTCACGCAGACTCTCGAGGTTCTCTGATTAGCACAGACTCTGGAAACAGCCTCCCTGACAAGACCAATGAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26701
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 1261 2074 34 53
Genomic Location (Zv9):
Chromosome 6 (position 12567891)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12421113
GRCz11 6 12655971
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACAGCCTCCCTGACAAGACCAATGAGAAGACCGGGTCACTCGAAAAG[G/A]TAAACTGCAATGACAGGAGCTCTCTGAGGCCCAAAATAACCTTTTATCTG
Long Flanking Sequence:
CACAGACTAAATGTGAGAGACGCATCTAATTTTAACACCAACCAGGTGAATCGTCTTTATAAACTTTGTTTTCTTCACCAGTGTATCATTCAGACCTTTCACCACACATGCCATCTGAAATGTTAGGTTGAACTCTATTTTTGTTTTCCTCAGAATGGTCGAGATGAACATCTTGCCAGCATCCCTAGCGCTACGCCCCAAAAGCCTGTTGGTAATCTCGACAACAGCCTACATAAAGATGTATTTGGGGTCATCTCAGGAACTGGTGAGTGTTGACGGAATCATAAACACACAGCTCAAGCCTTTCAACCGCTGTTGAGATCTTCAGAAGATGTTTGTGTAAATGATATAGCTTTACTGTGTGTGTAGCCTCTCCTCACACCTCCACGCCAAACATCGGCTCTGTGCGTCACGCAGACTCTCGAGGTTCTCTGATTAGCACAGACTCTGGAAACAGCCTCCCTGACAAGACCAATGAGAAGACCGGGTCACTCGAAAAG[G/A]TAAACTGCAATGACAGGAGCTCTCTGAGGCCCAAAATAACCTTTTATCTGCCTTTTTATAAATTGTAAGCTTCTGTTTTAAAACAATGCAGTTTGTAATAAGTCAAATAAAATCGGATTTGGTCACATATGGTGATAGAGGAGGAATGAAAACCCACTGGGTTTTTAATACTTGATTATAATTGTTTTAAATGGTTAGTTCACCACAGATTTAAAGCCATTTCATCATCATCATGTTCCAATATATGCTCAAGCATTAAAATAATAATAGTGTGCATCTGATTGAGACACAGTGTTCATGCAGATTAAGACCATGGTCTGTCTGAATGCTCTGATTGGTTCAAGATGAGTTCAGGGGTGAGTTTCCCCGAACAACGACGTAACTCTAACGGCTAACCTATCATAGTGCGATGCATCGTTTGATTAAAGAATGATGTAGTGACGAGTGTTTCCCAAAACCCATAGTTTCTGTCGCGGATCCATTGTTTGAACCACGTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15473
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Essential Splice Site 1338 2074 37 53
Genomic Location (Zv9):
Chromosome 6 (position 12560442)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12413664
GRCz11 6 12648522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTTTGTCTACATCAGTTCAGGTATATGGGGAAGAGGTTCATTGCCAGG[T/G]AAAAAATAAAWGTTTCACYCCTAAYAGCATACATTTTTCATTGCTTTTCW
Long Flanking Sequence:
GTGAATGATTCTCTGCGTAAAGCTTTTAGATGTCCTGGTATATGATATTTTGATGTGTTTTCCATATTATACTTAATGTATGTGTGTGTGGCAGACTCAGTCAGCCTCTGCTCTGGGTAGCTCTATGCTGCGCTGTGATAAATTGGACAGAGAAGAAATCAAAAACCTGCTCATGTGTTTCCTCCATGTCTTAAAGAGCATGTCAGAAGGTAAGAATATAGACACAAGACTCTAATTGTTAGATTCTCCATACCTTCTCATAGAAATTTGCTCTTTTTTTCCTCCTAGATGCCTTATTTACATACTGGAATAAAGCTACGACCTCTGAGCTGATGGACTTTTTCACTTTAGTAGAGTAAGTCATCTGGACTGGCACTAATTAGATCAGTACTGAGCTCCTGTAACTTAATACTGAGCACTCAGTTCATCTCTCTCTCTTTCTCATGCACAGAGTTTGTCTACATCAGTTCAGGTATATGGGGAAGAGGTTCATTGCCAGG[T/G]AAAAAATAAATGTTTCACTCCTAACAGCATACATTTTTCATTGCTTTTCATCCTGAATCATGCATATTTCTGTGGGAAATCCAGGATTTTTTAAGACAGTAATCATAATCATATTTTTGTTAAATAGATAATAATAACATAAATAACATAAATAACATTAAATACATAATTATATCTCAACAGATAAGGTGCACCTTCTACATTTTTAAATGACAAACTTTTAAAGTCTGCTTTTGAATATTTAGTTTTTTATTTAAAATTGTACTTTTTTTAAACAATATTTTAGTCTAAAGGCCTGAAGAGTTCCCAGTTACAGGCATACTTCTATACGTACACATACATACATACTAGGGCTGCACGATATATCATATCAGCATTGATATCGCAATGTGAACATGCACAATAGTCACATCGTAAGATATGCAATGATAAGTCTGAATTAAAGTTGACCAGGAGCTACAGAACATGTGATTTGTAGAGTCACTGCTAAGTTCAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Nonsense 1706 2074 46 53
Genomic Location (Zv9):
Chromosome 6 (position 12529451)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12382673
GRCz11 6 12617531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGAGGTGCTGATGGAGTTGTTGGAAGCGTGTGCTGATGGTTTATG[G/A]AAAGCAGAGCGCTATGAATTAATTTCAGATATCTACAAGCTCATCATCCC
Long Flanking Sequence:
TTTATTTTGCGTTTTTTATAAATGTCACATTTTTTTTTGAGTTGGAGTTGTAAAACAGGTGTATGTAAACTGTATATAACCAAAACCCGGTAAACACACTGAGATTAACCAAATCAGTAAGGAATGGCCTTCATTGCTGCGTAGTGATTGTTAACACATTAACCAACAGCTCACAGGAACAAGAAATTGGTCCCAAATGGGATATAAATAGTTATTATAGACAAAAGTTTGAATTGTAAAGCCTCACAAGGCACTTTATAAACTATCAACACTGCACACTTTAGCAAATCACTCCAATTAGAATCAATGTTGGATTATTGACATTTCTTAGATCAGCAGAAGCTTTTTGTGAGAAGATGATTTAGTTGTTCGGGGAGGTGTCATGATGGGATTGCATTAATTATGAGATACTGAGCATATAAATTTGTGCACATTTATATTGATGTCTCTCTGCAGGAGGTGCTGATGGAGTTGTTGGAAGCGTGTGCTGATGGTTTATG[G/A]AAAGCAGAGCGCTATGAATTAATTTCAGATATCTACAAGCTCATCATCCCCATTTACGAACAACGCAGAGACTTTGAGGTACGCAGAAACACACACACACATATTTATGTGAATCCAGTTTTCAAATTTTCTAGAAATACATATGCAGATGTACTGTATTAATGTAGTTTTGTGCTATTATGTAGAAACTGGCCCACCTGTATGACACATTACATCGGGCCTACACTAAAGTGATGGAGGTGATGCATTCTGGAAAGAGGCTACTCGGTACCTTTTTCAGAGTGGCATTTTTTGGTCAGGTAAGAAAATACAGCGCTTTCTAACAGTACAGCTAACACAGGCTGTTTGAATTAAATGCACTATGACAACAATATAACTGCATTTTTTAAAGGGGTCATATCATGAGGTATCAAATTTGATCTTGTTCTGTGAAAACATGTTTTGAATTTCATGCCTCTGGAGCTTCCTCCCTATTTGTCAAAAAAAAAAAAACTCGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13975
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090174 Nonsense 1879 2074 49 53
Genomic Location (Zv9):
Chromosome 6 (position 12515212)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12368434
GRCz11 6 12603292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTATTTGAAACACCGTTCACAGAGTCGGGCAAGAGGCATGGTGGAGTC[G/T]AGGAACAGTGTAAAYGCAGGAYGGTTCTMACTAGTGAGTGATCACTATCC
Long Flanking Sequence:
ACTATAAACTATCAGCTCTTCTTGCTATCTGCTATCTATTATTCTTGGTTTGATTTACTACACAGTATACAATGTTCAGCAGTCATCAAAATGCACTCTATGTTGAAATTATTTACTTAATCCTAGGCTCATTTAAACGTGTGTATAAACAAACACACACATACAAGACGAGTATTACATTATACAAATGATTTGACAACATGCCTGCTGATATGCAGTCCACTTTAACCAGTCTCACTTTAACCCCAGTCCACAGACAACAGTTTTGTTTATTCATTTTTTATCAGCAGTTTTTGTACATCTCATTTTTACATCTTTCCCAGGTGAATCCTAAAGATCTGGAGGCAAAGTTCGCCTACATCCAAGTCACGCATGTGACGCCATATCTGGAGGAAAAGGAGCTCGAAGAGAGGAAGACTGACTTTGAGAGAAGCCACAACATTCGCCGATTTGTATTTGAAACACCGTTCACAGAGTCGGGCAAGAGGCATGGTGGAGTC[G/T]AGGAACAGTGTAAACGCAGGACGGTTCTAACTAGTGAGTGATCACTATCCCTGACTTTACAACTGTTGCATAAAAAGTGTAGCACACGCATAATGTGTAGGAAATTGATGCTTTATTCTACTACATTTAATTGACTAAAAAACCCTTACGCCACCACTTATCTACCGTCAACCCAATCAATCATAGTTCCACTTGTTTACTTTCGATTATTACAATATGTTTTCCTGTGAAGTGGACCTGTCCCTCCTGCAGCAAAACAGCCCCACAACATGATGCTGCCGCCCCCATACTTCACAGTTGGGATGGTGTTCCTAGGCTTGTAAGCTTTCCCCTTTGTCCTCCAACTGTAACACTGGTCATTATGGCCAAACAGTTCAATCTTAGTTCCATCAGACCACAGGACATGTCTCCAAAAATTATTATTTTTCCCAGATTAATTTAGCAAATTGTAATCTGGCTTTTTTGTTGATTCTGGCTTGTTTGTTGATTTTGCCATGTTG
Associated Phenotype:
Not determined