Busch Lab

ZMP

upf1

Ensembl ID:
ENSDARG00000016302
ZFIN ID:
ZDB-GENE-040426-2836
Description:
regulator of nonsense transcripts 1 [Source:RefSeq peptide;Acc:NP_998639]
Human Orthologue:
UPF1
Human Description:
UPF1 regulator of nonsense transcripts homolog (yeast) [Source:HGNC Symbol;Acc:9962]
Mouse Orthologue:
Upf1
Mouse Description:
UPF1 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107995]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39953 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7535 Missense Mutation detected in F1 DNA Not yet available
sa11856 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39953
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Essential Splice Site 304 1100 7 24
ENSDART00000138047 Essential Splice Site 304 557 7 13
Genomic Location (Zv9):
Chromosome 2 (position 56404057)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56067125
GRCz11 2 56190970
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTCATGCTTCTGTTTTCTCTTTGTTCATCTTCCTGTATTTTCACTCC[A/G]GACTCAAGACAATATAACAGTGAGGTGGGATTTGGGACTGAATAAAAAGC
Long Flanking Sequence:
AGGAACGCTTTCTCTGCCATTCCAGATGACTTTATTAATCAGTGATTTGAGTCATGTCAGAGATGTATGGATGCAGTCCTCCAAGCTCATGATGGAGTCAGACACAATATTCATTCTGTCTCCACTGCTCCACTGGTCAAATAAGTGTAATCTAGAGGCCTCTGCCTTTGATATAAGCCACTTCTGATGCAAAATGATCAACTAGAAGTCAAGTTATTATTTGTTGCTTCTAAAACTTGGGTAGGCGACAGGACTTTTGTCAGGTAGTGTATATTGCATCATTAAAACTGATTGAGGTCATGTCAAAGTGTTGTGCGATGAGTCGATTGTGACAGGCCTACAGATGTGTTTCCTATCTCTCTTGATGCGCGAGTTTCTTGCTTATTAGTTAAAAAGATTTTCTAAAAATGTCTGAATGATTCTTCCATGTACAAAATCTGATTTAATTACATGTTCATGCTTCTGTTTTCTCTTTGTTCATCTTCCTGTATTTTCACTCC[A/G]GACTCAAGACAATATAACAGTGAGGTGGGATTTGGGACTGAATAAAAAGCGGATAGCTTATTTCACTCTGCCCAAGACGGATTCAGGTGGTAATATTTACTTTCAACATCTTCTGTGTCTACCAGTGGTTCATATCCATCCCATCCCTAACACCGAGTCCCATGCATCCCTCATCGATGTGTGCACGGACCTGTCTGCCCGAGTGTGTGTATGTGTGCGCGTGTGTGCTTTAGGGATGTCAAACTTGTTAGTTTCTTCAATGCATTGTGCTGAAGATTCAGTATGGATTCAGTTCAGTAATAAAAGCTGAACATTAGGCTTTAGTGAAATATGACCAGTCCAAAACATACTGGTCCCATTTATCATATATGCACTATAAACATAGGCGTGTAAGTAGCCATTCATCAGCGCGCAAAAAAGCAAGCAGGGAAAATGTTGGTAGTCCACATTTATTATGCGCTTTTATAATTTACTTGCATTTGTTCAAATCACTCCAGTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3416
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Nonsense 343 1100 8 24
ENSDART00000138047 Nonsense 343 557 8 13
Genomic Location (Zv9):
Chromosome 2 (position 56407158)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56070226
GRCz11 2 56194071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGGGTGATGTCTATCAGACATGCGGCTGATGCAAGGAGACGAGATCTG[T/A]CTGCGCTATAAAGGAGACATGGCTCCGCTCTGGAAAGGCATCGGACATGT
Long Flanking Sequence:
CGATGCTAAATTTTAGCTGTCTATGAAAATCTAATAGACGTTTAAGAATAGCCCAACATTAGACTAATCATCAAATAGACCAGTGATTCTCAACCATGGTTCTGGAGGTCTACCAACACTGCATGTTTTGAATGTCTCCTTTGTCACACCCATTACAGGAATTTCCATTTCAGCTAATGAGCTGATGATCTGAATCAGGTGTGTTTGATAAATGCGCAGAGCTGCTGGTCCTCCAGGAACATGGTTGAGAAACACTGACATAGACTTTACATTTGTAGTTATTTATTCCTGTTTATTTAATGCCTAGTCTAGTTTTGGGCTGTTCTTATACCGTTATTTATTTCGCTGACAGCTAAGATTTAGCCTGGACGTCTATTAGACTTATTTTAAAGACAAAACTGCTTGCTGGGAAGTCTGTAAGATGTGATTAATCTGATTGTGTTTTCTCTGTGTGGGTGATGTCTATCAGACATGCGGCTGATGCAAGGAGACGAGATCTG[T/A]CTGCGCTATAAAGGAGACATGGCTCCGCTCTGGAAAGGCATCGGACATGTCATCAAAGTCCCGGACAGTATCCTTTCAGGCTGTTATTACGCAATGACAACTATTATTTTCTCCTGATGATGTGCTTAGGCATGCATTTCTCATGCTTCAATGATTTGATGAGCAACCGCCCAGAACACCCTGCATTGCAGGCGCTCAGTAAATTCTAGCAACTGGATGGCAAAACTCTCACAACACTCTGTCATTATGATTTACAAGCACCCTCTATTACAGAAGAGGGTCAGAATGTCCTGACTGCACTTTTTAAGGGATAGTTCAGCCATTAGTTTTAACTTTTTAAAAATTTGTAATAAATATAAAAAGTTTCCTTCCATCTATATGCGGATGACATTCAGATGTATTTTCCTCTAAACAAAAAGATATTAATGGCTTACAGCCACTCCTGGCTTGCTTAGAGGAGCATTTGGGCACAAAGAAAATCCTCTGTTAGATGTCAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Missense 451 1100 10 24
ENSDART00000138047 Missense 451 557 10 13
Genomic Location (Zv9):
Chromosome 2 (position 56412049)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56075117
GRCz11 2 56198962
KASP Assay ID:
554-4152.1 (used for ordering genotyping assays)
KASP Sequence:
CATCAAATGCCAGCTACCYAAACGCTTCACTGCGCAGGGCCTGCCAGACC[T/C]CAACCACTCGCAGGTACAGARATGWACAAACTSRCATCTYTCTCWTAACT
Long Flanking Sequence:
ATAACCATGCAATTACAGTAAGACCAAAAGCTTTTTACAGTCAAACGTTTTAGAAAACCATTGGCAAAATGCATAATTACAACTTTTGCTCTGTTAAACACAAAGCTGTCATACAACTTTACATTAGTTATTCCTAATACAATAAGGCAGAAAAGGAAGAAAAACAATTACTATAAATCAGACAAATGCAAATAGAAAAACAATCAAGGTCACGGTTTATACCTGGAGATGTAGTCACTGTAATCATCATTGTTTGTCATTGCATAGAAAAAAAACTGTGTGTGTTAATTTTCTGATGAGCTCTCACTTCAAGTAGCCTCATGATCTCAGCTTTATGTTTGTGGTGTAATGTAGAATGCAGAGCGCCCTGAAGACGTTTGCTGTGGATGAGACCTCTGTGTCAGGCTACATCTACCACAAGCTGCTGGGTCACGAGGTGGAGGACGTGATCATCAAATGCCAGCTACCTAAACGCTTCACTGCGCAGGGCCTGCCAGACC[T/C]CAACCACTCGCAGGTACAGAAATGTACAAACTCGCATCTTTCTCATAACTTTCTTGGGGCTCGAGTGTTGGCATGGGCCCGTATAAGACTCTGATGGTATGATAACCTTGGATAAAAAGGTCACAATATTGTGAATACATCTCTAAAATATGTTCTTTTTAAATGTTTTACTTTTAAAACAAAAAAATAAATCTTTTACTTTTACTGCTACTTTTTGTCCTCATTAAACACATTATTTTTAATTTTAAGCAACATTTATACTATTTTGGTGCAGTAAACATGTCAGGCTAAATAATTGAAATAAAGCTTTGACTTCTGCTGTCTTCATTAGTTTCAAAAACACAGATTTCTTAAAGATAATAATAATTCCTTACATTTATAAAGCGCTTTTCTGGGCACTCAGTGCTTTACACAATGGTGGGGAATCTCCTCATCCACCACCAGTATGCAGCATCCACCTGGATAACGCGACGGAAGCCATTTTGCGCCAGACCGCACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25942
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Nonsense 518 1100 12 24
ENSDART00000138047 Nonsense 518 557 12 13
Genomic Location (Zv9):
Chromosome 2 (position 56418751)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56081819
GRCz11 2 56205664
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCGAGTAACATCGCTGTGGACCAGCTAACAGAGAAGATCCATCAGACG[G/T]GACTGAAGGTGGTTCGTCTGTGTGCTAAGAGTCGTGAGGCCATCGATTCA
Long Flanking Sequence:
AAAGTACAATCCAGAATGTCGTGTAATGAAAAAAAATCATGCATAAAAATTTTGTGGTAACAGTTGCTTTTTTCTCATGTTAACTGTGCATCTTTGTTGTGCAGCACATTTTAACAAAAAAAATAAATACAAGTAATTGTTTAATTTTACTTTATATCTTAATTTATTGATCCTTTTGAGTCAGAACAAAAATTCTGAGATGCACAATTTTATCACCAAAGTATATGTAATTAATAAAATTCATAATACTAATTAAATTAATTAGACATGCTTTATGATTAACATATGCTTCTTTTGTTTAAATGTCAACTAAACCTCACAATTTCTATACCATTAATAAACAATCCAGAAAAATGTAAAGAATAAAACATTTTATAGGTCCTATTGTATCTAATCTGTTTTTTTTCTCCTTTTGTGCTGTCTCCATGTGTAGTCCAGTGCTGGTTTGTGCGCCGAGTAACATCGCTGTGGACCAGCTAACAGAGAAGATCCATCAGACG[G/T]GACTGAAGGTGGTTCGTCTGTGTGCTAAGAGTCGTGAGGCCATCGATTCACCTGTGTCTTTCCTGGCTCTGCACAATCAGATCCGCAACATGGACAGGTACCACCATTTCTGTTCTTAACCCTGGTGTGCTGTAGGGGATGATTTCATCCACTCCGGGAGGATTTTGAGGCTTAATTTGGCCACAACTTTTTTCAGCAAATGAGCAGATTTTTGGTGACAACTCTTATTTTGACACATATTTTGGGAAATGCTTTGGAATTTTTCAAAAACTCAACAATAAGCTCTGGGCAAATTGACTTCCTTTTCGTTATGTTGGGCGCTGTTTTTGCCCCATTGACTTCCATTATAATGACATTTTTTAATTGCAAAGCCATGACGGCATATAATCATACATTCCTGATTGTTGCTGGTTTTCGGGCAGGGTTTCAACAACTGTAATTTTTGTCTTTGGAATCCATTCAGGCTGAAGAAACTAATATATATATATATATATATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021011 Essential Splice Site 906 1100 20 24
ENSDART00000138047 None None 557 None 13
Genomic Location (Zv9):
Chromosome 2 (position 56435088)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 56098156
GRCz11 2 56222001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATACATMRAAGGCCATRAAGTCCATCTGACAGTGTWAATGTTTGTTTC[A/T]GGGAGCCCGCTTCATGAGTACCGCCATGTATGATGCAAGGGAGGYCATGA
Long Flanking Sequence:
TCAGGTTCTATCTGACATTTTTGTCAAAATTGAGTTATAGACATATTCTTATTAAATGACAACTTATTTACATTTTTTATAAGTTTTTTATAAGTTGTTTACATTTAAAGACTTTTTATTTAAAAAATAAAAAAGATTTTATCTACAAAATTAAACTCTAGCCTGCATATCAAATGCACACACAAGGACCAATCAGGATCAGCTTTCTTTGTCAATTTTCCGGACTGCAACATTGACAGTGGAAAAGACCAAAAGAAATACAAAATCATTAAAGTCAACTAAATAATGCTGCACCACGCAAAATTAAGAAGAAACCTAAAACTGAAAAGATGTGTGTAAATGTGATGATTTGGAAGCTTTTTTTTTTTTACATTGAGATGAAATGTTAAACTTGACATTGTTGAATATAATGTAATATAAGGTGAAATATTTTTATTTGTGTGTGTGTGTATATACATCAAAGGCCATAAAGTCCATCTGACAGTGTTAATGTTTGTTTC[A/T]GGGAGCCCGCTTCATGAGTACCGCCATGTATGATGCAAGGGAGGCCATGATTCCTGGATCTGTGTATGATCGCAGCAGCACTGGTGAGAAACTCATATTAAAGTTTTCTTAGCAGTGGACAATTAGGGGAATGATCATGTTGCCTTGGTTCATTTTATCCGCTAGCTCATTGATCCTCAACCACCGGTCTGTGGGTTAATTGGTACCGGGCTGCACAATAAATCAATAATTATTTCCGTTTTATTTATTTTCTGAGTCTAAACAATCTTTTATTTTAAAAGTCTTTTATTTTGAAAAATGACCCTATTCTCACGGTCACTTGAGCACCCAAATTGAGCCCACAAGCAGCAAAATGTGTAAGAAACAGTCAGTGGAAAGTTTCTTTGCTAAGGGAAAAAGGCCCAGTGAAGGACCCGTAAACTGCCAAGGAATGGATCCACAACCCATTTGTCAACAAATCCAGCATGTCTCTGCAAGAAGGTCAACTGATGGAGGTCGCA
Associated Phenotype:
Not determined