Busch Lab

ZMP

fxr2

Ensembl ID:
ENSDARG00000016260
ZFIN ID:
ZDB-GENE-040426-943
Description:
fragile X mental retardation syndrome-related protein 2 [Source:RefSeq peptide;Acc:NP_956505]
Human Orthologue:
FXR2
Human Description:
fragile X mental retardation, autosomal homolog 2 [Source:HGNC Symbol;Acc:4024]
Mouse Orthologue:
Fxr2
Mouse Description:
fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1346074]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11430 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027718 Splice Site, Nonsense 448 676 12 17
ENSDART00000143341 Splice Site, Nonsense 448 583 12 15
Genomic Location (Zv9):
Chromosome 7 (position 23906210)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22467962
GRCz11 7 22739119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGGAGGAAGAGGACGCGGACGCAAACCGAACAATACATACTCCGGCTA[T/A]GGTGAGACTGGAACTTACACAATGCATATCTGTCTGTGTGTGTTTARTAG
Associated Phenotype:
Not determined