Busch Lab

ZMP

nudt3a

Ensembl ID:
ENSDARG00000016256
ZFIN ID:
ZDB-GENE-040426-792
Description:
diphosphoinositol polyphosphate phosphohydrolase 2 [Source:RefSeq peptide;Acc:NP_957439]
Human Orthologue:
NUDT3
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 3 [Source:HGNC Symbol;Acc:8050]
Mouse Orthologue:
Nudt3
Mouse Description:
nudix (nucleotide diphosphate linked moiety X)-type motif 3 Gene [Source:MGI Symbol;Acc:MGI:1928484]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa380 Essential Splice Site Available for shipment Available now
sa25190 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026978 Essential Splice Site 71 170 3 7
ENSDART00000061713 Essential Splice Site 71 170 3 6
ENSDART00000141682 Essential Splice Site 71 170 3 5
Genomic Location (Zv9):
Chromosome 23 (position 3729704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3773079
GRCz11 23 3715982
KASP Assay ID:
554-0360.1 (used for ordering genotyping assays)
KASP Sequence:
TTAAAAATGTCCTGAATTGAGTGTTTCACTGTTTTTTTTTTTATTCCCAC[A/T]GGCAGGAGTCAAAGGTACATTAGGAAGATTGGTAGGTGTTTTTGAGGTGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25190
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026978 None None 170 7 7
ENSDART00000061713 Essential Splice Site None 170 6 6
ENSDART00000141682 None None 170 5 5
Genomic Location (Zv9):
Chromosome 23 (position 3726027)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3769402
KASP Assay ID:
554-7411.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTAATGCGATTAGTTGACTTTAAAGTTGGTAAACTCGTTTCTTTTAA[A/T]GGGGTGGTCCACTATGATATCATATTTTAAACTTTAGTTGATGTGTAATG
Associated Phenotype:
Not determined