Busch Lab

ZMP

zgc:76925

Ensembl ID:
ENSDARG00000016233
ZFIN ID:
ZDB-GENE-040426-2049
Description:
epidermal retinal dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_998043]
Human Orthologue:
SDR16C5
Human Description:
short chain dehydrogenase/reductase family 16C, member 5 [Source:HGNC Symbol;Acc:30311]
Mouse Orthologues:
Sdr16c5, Sdr16c6
Mouse Descriptions:
short chain dehydrogenase/reductase family 16C, member 5 Gene [Source:MGI Symbol;Acc:MGI:2668443]
short chain dehydrogenase/reductase family 16C, member 6 Gene [Source:MGI Symbol;Acc:MGI:2685269]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13390 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13390
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019392 Essential Splice Site 107 306 2 7
Genomic Location (Zv9):
Chromosome 2 (position 11294824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11719920
GRCz11 2 11503519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGTGTGACTGCAGTGATAGAGAAGCAGTGTATCGAGTGGCAGATCAGG[T/A]AAGCCGAGTTCAAACCGCCGCTGTGAGTTGTTTTGCTGGAATGAAGAGTA
Associated Phenotype:
Not determined