Busch Lab

ZMP

zgc:112408

Ensembl ID:
ENSDARG00000016207
ZFIN ID:
ZDB-GENE-050417-63
Description:
hypothetical protein LOC550260 [Source:RefSeq peptide;Acc:NP_001017597]
Human Orthologues:
STOM, STOML3
Human Descriptions:
stomatin (EPB72)-like 3 [Source:HGNC Symbol;Acc:19420]
stomatin [Source:HGNC Symbol;Acc:3383]
Mouse Orthologues:
Stom, Stoml3
Mouse Descriptions:
stomatin (Epb7.2)-like 3 Gene [Source:MGI Symbol;Acc:MGI:2388072]
stomatin Gene [Source:MGI Symbol;Acc:MGI:95403]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9379 Nonsense Mutation detected in F1 DNA Not yet available
sa17227 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5077
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043390 Essential Splice Site 29 291 1 7
ENSDART00000144394 Essential Splice Site 42 304 1 7
Genomic Location (Zv9):
Chromosome 24 (position 24672637)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23919515
GRCz11 24 24064689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAACCTATCGCAAATGAAGAGAGTGACACAAATGTCATAGTCCAGTCAG[G/A]TTTGTAKAGTTTTTCTTGATTTCTTGTTATATTTAATCAGCNNNNNNTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9379
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043390 Nonsense 78 291 3 7
ENSDART00000144394 Nonsense 91 304 3 7
Genomic Location (Zv9):
Chromosome 24 (position 24673011)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23919889
GRCz11 24 24065063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTATTAAAAGRTTGTTCAAGAATATGAGAGAGCTGTTATTTTYCGTT[T/A]GGGACGACTCCTTGGAGGTGCTAAAGGACCTGGTTAGTACTTTGAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17227
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043390 Nonsense 150 291 5 7
ENSDART00000144394 Nonsense 163 304 5 7
Genomic Location (Zv9):
Chromosome 24 (position 24675416)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23922294
GRCz11 24 24067468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAATCTTTAACCCCACTGTCTCCATTACTAAAGTGGAGAATGCAAATTA[T/A]GCTACAYAGATGMTTGCACAGACTACATTACGAAACATGCTCGGAACTAA
Associated Phenotype:
Not determined