Busch Lab

ZMP

gmpr

Ensembl ID:
ENSDARG00000016160
ZFIN ID:
ZDB-GENE-050522-48
Description:
GMP reductase 1 [Source:RefSeq peptide;Acc:NP_001018448]
Human Orthologue:
GMPR
Human Description:
guanosine monophosphate reductase [Source:HGNC Symbol;Acc:4376]
Mouse Orthologue:
Gmpr
Mouse Description:
guanosine monophosphate reductase Gene [Source:MGI Symbol;Acc:MGI:1913605]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43308 Nonsense Mutation detected in F1 DNA Not yet available
sa45678 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050130 Nonsense 45 345 2 9
Genomic Location (Zv9):
Chromosome 19 (position 33857791)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32895207
GRCz11 19 32482327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGTTGACCTGCAGAGGACCTTCACATTCCGGAACTCAAAGCAGACGTA[C/A]AATGGCATCCCGATCATCGCTGCTAACATGGACACCACCGGCACTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050130 Nonsense 208 345 6 9
Genomic Location (Zv9):
Chromosome 19 (position 33853899)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 32891315
GRCz11 19 32478435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACCGGTGTGGGTTATCCTCAGCTGAGCGCTGTTATCGAGTGTGCTGACT[C/A]GGCCCATGGACTGAAAGGACACATCATCTCTGTGAGTCTTTTGGCAGTAT
Associated Phenotype:
Not determined