Busch Lab

ZMP

dag1

Ensembl ID:
ENSDARG00000016153
ZFIN ID:
ZDB-GENE-021223-1
Description:
dystroglycan [Source:RefSeq peptide;Acc:NP_775381]
Human Orthologue:
DAG1
Human Description:
dystroglycan 1 (dystrophin-associated glycoprotein 1) [Source:HGNC Symbol;Acc:2666]
Mouse Orthologue:
Dag1
Mouse Description:
dystroglycan 1 Gene [Source:MGI Symbol;Acc:MGI:101864]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11376 Nonsense Available for shipment Available now
sa43877 Nonsense Mutation detected in F1 DNA Not yet available
hu3072 Nonsense Confirmed mutation in F2 line Not yet available
sa8855 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11376
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 278 866 3 3
ENSDART00000126885 Nonsense 278 866 2 2
Genomic Location (Zv9):
Chromosome 22 (position 36070786)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33236124
GRCz11 22 33190695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTTGAAAACGGAGCTCTTTTGTCCTGGAAGCTCGGCTGCAGTCTGGAT[C/T]AAAGCAGCATTCCTGACATTAGCAGTGTTCAGGTTCCAGCAAAAGAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43877
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 340 866 3 3
ENSDART00000126885 Nonsense 340 866 2 2
Genomic Location (Zv9):
Chromosome 22 (position 36070974)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33236312
GRCz11 22 33190883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAACAACACCCCCACTCCCATTCCCTCATTACTCCCTCCTACAACTTA[C/A]CCTGAGCCCCCGATCCGCATCGTTCCAACTCCAACCTCTCCATCTATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3072
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 398 866 3 3
ENSDART00000126885 Nonsense 398 866 2 2
Genomic Location (Zv9):
Chromosome 22 (position 36071146)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33236484
GRCz11 22 33191055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGGATTCCGCGCCCTCCACTCCAACCTTAGGCCCCCCTCTGCCAACA[C/T]GAGTAATGGTCACCACCAGCACTATCGCCATCCAGCCAACAATGACCAGG
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control; 5 dpf
Control; 5 dpf
Mutant; 5 dpf
Mutant; 5 dpf
Control; 5 dpf
Control; 5 dpf
Mutant; 5 dpf
Mutant; 5 dpf
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
skeletal muscle
ZFA:0005277
degenerate
PATO:0000639
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8855
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004504 Nonsense 537 866 3 3
ENSDART00000126885 Nonsense 537 866 2 2
Genomic Location (Zv9):
Chromosome 22 (position 36071563)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33236901
GRCz11 22 33191472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCGCKGATGATTCCTGGATACAGTTTAATAGCACAAGCCAGTTACTGTAT[G/T]GATTACCTGACCAAGAGCATGCAGGGAAACAWGAGTATTTCATGCAAGCA
Associated Phenotype:
Not determined