Busch Lab

ZMP

si:ch73-38f1.1

Ensembl ID:
ENSDARG00000016116
ZFIN ID:
ZDB-GENE-081028-51
Description:
Novel protein similar to vertebrate early B-cell factor 3 (EBF3) [Source:UniProtKB/TrEMBL;Acc:B8JKJ0
Human Orthologue:
EBF1
Human Description:
early B-cell factor 1 [Source:HGNC Symbol;Acc:3126]
Mouse Orthologue:
Ebf1
Mouse Description:
early B-cell factor 1 Gene [Source:MGI Symbol;Acc:MGI:95275]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35725 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35726 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35725
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006698 Essential Splice Site 45 591 2 17
ENSDART00000134114 None None 335 None 8
Genomic Location (Zv9):
Chromosome 14 (position 36183736)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34685064
GRCz11 14 35025378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATAAATACATCCATCATCATTCTGTCTGTCTTTCTTCTGTGTGTTTAT[A/T]GTGGAGTGGGTCTTGCTCGAGCACACTTTGAGAAGCAACCTCCTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35726
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006698 Nonsense 263 591 9 17
ENSDART00000134114 Nonsense 82 335 3 8
Genomic Location (Zv9):
Chromosome 14 (position 36342979)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34844307
GRCz11 14 35184621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCCTCTGTCTGACTCTTTTCTTTTGCTCTTTCTAACAGCTACTCCTTG[C/A]ATTAAGGCCATCAGTCCCAGTGAAGGCTGGACGACAGGGGGTGCAACAGT
Associated Phenotype:
Not determined