Busch Lab

ZMP

dbnl

Ensembl ID:
ENSDARG00000016016
ZFIN ID:
ZDB-GENE-050522-293
Description:
drebrin-like protein [Source:RefSeq peptide;Acc:NP_001018536]
Human Orthologue:
DBNL
Human Description:
drebrin-like [Source:HGNC Symbol;Acc:2696]
Mouse Orthologue:
Dbnl
Mouse Description:
drebrin-like Gene [Source:MGI Symbol;Acc:MGI:700006]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34516 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34516
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013059 Nonsense 134 420 5 14
ENSDART00000125241 Nonsense 134 476 5 15
Genomic Location (Zv9):
Chromosome 8 (position 54604406)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52339178
GRCz11 8 52325707
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGTGCGGAGGAGGACGTGGAGCCTGATGCTGTCATGGAGAAAGTGGCC[A/T]AAGCTTCAGGAGCAAACTACAGCTTTCACAAAGAGACCAGCCGCTTCAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18933
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013059 Essential Splice Site 235 420 7 14
ENSDART00000125241 Essential Splice Site 235 476 7 15
Genomic Location (Zv9):
Chromosome 8 (position 54608494)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52343266
GRCz11 8 52329795
KASP Assay ID:
2260-1240.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACGAGACAAGAAGACCAAAGAGAGAGCGTCACAGATAGACGAGCAGAG[G/A]TCAGCTCCAGCAAAGACACACTGTTGTGATGCGCAGTTGAAGTCAGAATT
Associated Phenotype:
Not determined