Busch Lab

ZMP

gpcpd1

Ensembl ID:
ENSDARG00000016011
ZFIN ID:
ZDB-GENE-060503-472
Description:
preimplantation protein 4-like [Source:RefSeq peptide;Acc:NP_001103993]
Human Orthologue:
GPCPD1
Human Description:
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26957]
Mouse Orthologue:
Gpcpd1
Mouse Description:
glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12862 Nonsense Available for shipment Available now
sa13354 Nonsense Available for shipment Available now
sa23800 Nonsense Available for shipment Available now
sa23799 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12862
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 49 666 4 20
ENSDART00000124283 Nonsense 49 666 3 19
Genomic Location (Zv9):
Chromosome 20 (position 45908587)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45802276
GRCz11 20 45705996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTAYCTCCTGTGTTTTGCTCACATGCCYTCTCTCACCTCCCAGCACCT[T/A]ATGGAGAACAACCATTCACGTTCCTAGAGGAGCTGAAACCAAAWATCGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29451
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 364 666 12 20
ENSDART00000124283 Nonsense 364 666 11 19
Genomic Location (Zv9):
Chromosome 20 (position 45888421)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45782110
GRCz11 20 45685830
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCACAGGGAGCCGCTTACGTAGAGTTTGATGTTCATCTGTCTAAAGATT[T/A]AGTTCCAGTCGTTTACCACGATCTCACTTGCTGTATTTCTACTAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13354
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 375 666 12 20
ENSDART00000124283 Nonsense 375 666 11 19
Genomic Location (Zv9):
Chromosome 20 (position 45888387)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45782076
GRCz11 20 45685796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCTGTCTAAAGATTTAGTTCCWGTCGTTTACCACGATCTCACTTGCTG[T/A]ATTTCTACTAAAAAGGTAACACATTGTTTGCTGGAGTCAATGTTAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23800
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 388 666 13 20
ENSDART00000124283 Nonsense 388 666 12 19
Genomic Location (Zv9):
Chromosome 20 (position 45884874)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45778563
GRCz11 20 45682283
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTTCTGGTCTTGTTCGCTTTCCTAGAAAAATGACAAGACTTCAATGT[T/A]GTTGTTCGAAGTTCCTGTCAAAGATCTTACATTTGATCAACTTCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23799
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027482 Nonsense 515 666 18 20
ENSDART00000124283 Nonsense 515 666 17 19
Genomic Location (Zv9):
Chromosome 20 (position 45880101)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45773790
GRCz11 20 45677510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCAAAAAATGTGTGTTTTCTACAGGGTGAGGCAGAAACAGAACAAATA[T/A]CCGATCCTGTTTCTGACCCAAGGAGTGACACAGCTCTATCCTGAGCTCAT
Associated Phenotype:
Not determined