Busch Lab

ZMP

mfsd5

Ensembl ID:
ENSDARG00000015997
ZFIN ID:
ZDB-GENE-040718-468
Description:
Major facilitator superfamily domain-containing protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q6DG19]
Human Orthologue:
MFSD5
Human Description:
major facilitator superfamily domain containing 5 [Source:HGNC Symbol;Acc:28156]
Mouse Orthologue:
Mfsd5
Mouse Description:
major facilitator superfamily domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2145901]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12309 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011004 None None 481 2 3
ENSDART00000141141 Essential Splice Site None 200 2 3
ENSDART00000142369 Essential Splice Site None 152 2 3
Genomic Location (Zv9):
Chromosome 23 (position 35841422)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35691075
GRCz11 23 35789878
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCTTTTTTNCAGAAGTCAAGCTGACAGTYGCTCATGATGAGTCCAGAA[G/A]TGAGTTTATCCAACWGTCATGTGTCACGTGATGATGTATGATCACTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29983
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011004 Nonsense 227 481 3 3
ENSDART00000141141 None None 200 None 3
ENSDART00000142369 None None 152 None 3
Genomic Location (Zv9):
Chromosome 23 (position 35840504)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 35690157
GRCz11 23 35788960
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATCCCGAGCCTTGCTGCTTGCGCCTGGTTTGTGCTTTCCGAATGGGGT[C/T]AGGAGGACAAACAAGAAGGCATGAATGGAGACAAAAACGCCCCCCTTCTT
Associated Phenotype:
Not determined