Busch Lab

ZMP

abcc9

Ensembl ID:
ENSDARG00000015985
ZFIN ID:
ZDB-GENE-050517-23
Description:
ATP-binding cassette sub-family C member 9 [Source:RefSeq peptide;Acc:NP_001025325]
Human Orthologue:
ABCC9
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:60]
Mouse Orthologue:
Abcc9
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1352630]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa26260 Nonsense Mutation detected in F1 DNA Not yet available
sa8414 Nonsense Mutation detected in F1 DNA Not yet available
sa8868 Nonsense Mutation detected in F1 DNA Not yet available
sa18175 Essential Splice Site Available for shipment Available now
sa17129 Nonsense Available for shipment Available now
sa38431 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26260
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 143 1558 4 37
ENSDART00000079987 Nonsense 55 1409 2 33
Genomic Location (Zv9):
Chromosome 4 (position 13730723)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14666576
GRCz11 4 14665331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCAAACCTAATCAACCTAACCTCTTTCACAGCCTTATTTATTTACTG[G/A]ATTCTGGCTTTCATCACAAAGATGATAAAGTTATGGAAGTTTGCCGAGGC
Long Flanking Sequence:
ACACGTGTGTGAGATCGCTGAGGGAATCGTCTCCAATACGTGGGTTTCATTTCAACATATGCCTGTGCAGTTTATTAATGTGTCTGTACTGTTTTATTTACCTCTTCGTGCATGAATCTTGCTTTGCAGGCAGATGGAGTCTAATCACTTGCACCTCTTCATGCCAGCATTTATGGGCTTTATAGCAGCCACCACATCGGTTGTGTATTACCACAATATTGAAACAGCCAATTTCCCCAAACTCCTGCTGGGTAAGTGTCTATTTCATCATGCAGGTAGGCACTTCATAATAAAATGTACTTGCAGTGTGGTTGTTTCATTATGTTACATTTACTCCTACTCTAATTTAAATAAAGCATAGTCGTTTTGCACGTTGCTCGGTAACGCAATGGTCCAACCATATTTTTAGACATTGTCAGTAGTATTTTTTGCCTAGTGGTTGAGTATGAATATTCAAACCTAATCAACCTAACCTCTTTCACAGCCTTATTTATTTACTG[G/A]ATTCTGGCTTTCATCACAAAGATGATAAAGTTATGGAAGTTTGCCGAGGCGAGCTTGGGGGTACAACATCTCCGCTTCTGTATCACAGCGTTGCTTGTGGTGCTCTACGGCCTACTCATGGCTGTCGAGATCAACGTTATCAGAGTCAGGGTGAGTTTAGACATGTTTATTATTTATTTTAATTTTTTTCTATAAGCACTTAATTACACAATTATATACACAAATAAAATCTAAGCAAATTTCAGGCATTTTATTCAATTAATTTTTTTAATAATTATATTTATATTGTTAGTATTTATCTATTTTATTTTATTTAGTCCAGTGGATTTATTATTCTCAGCTTAAATGATTCAATAAAAACTAATCATGTACACAACTTTATGTATTGCACCAAATATGAATATTTTTCATATCAGGATTACACACACGTACACAAATCTTTTATTTTATTCAATATTTTATTTACTTTTTAACCATTCTTTATTTATTTTTTTTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8414
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
Genomic Location (Zv9):
Chromosome 4 (position 13741511)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14677364
GRCz11 4 14676119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
Long Flanking Sequence:
CAGGGCAAAATAATATTCAAGCTAAAAACAATGTAATGTGTTATTACATAATATTGACATTTTATTTTTGTTGTATTATTAAGATACAAGTTCAACATTACATAATATTGACATACTTTTTTATGTTATATTATTAATGCACAAGTACAACAGCATCATGCTTTTTCAGTTTATTAGATTCCATGGAAATTCAGTTTTCTGAAGTGAGAGAATTTGATAATTGGTTTAAACCCTGTAAACTGCTTCCCTTGAAATTTCCCTCCCTCAATCCATACTGTCATTTGCTGATTTGATAGTACATTAACTGAAGTTTTCTTTTTCTTCATCTTCACAGTATTTATGAATGCCGCCATTCCCATTGCTGCAGTGTTGGCGGTAAGAGATGCACAATCACAGGCTTTGATCCGGTTGTATTTTTTCCAGTGTGACCATACGCACTCTTGTTATTGTAGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCTCTATTCCACATCCTGGTCACTCCACTCTTCCTTTTGTCCACGGTTGTCAGGTTTGCCGTCAAGGCTCTTGTCAGGTATGTGGCTAAACTAAATCAGCAGTAAAATGTTACTTTGGAAGGATCTAATCATCTGATTGATGTCTGCAGTGTACAGAAGCTCAGCGAGTTCCTGCAAAGTGATGAGATTGGAGACGACAGCTGGAGAAATGGAGATATGTGCATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGATGTGAGTAGGCACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCATGGGTTCTGAAAAATTTGCTCTAATTTGCTCTTATTTAATATTAACCGCACCTAATGGGACTGGTTGACACAATATTTAAGTTACATAACAAGTCTTTTCTTGGCTTAATTTTGGAGACTCTCTGAGATCCACTCTGTCTTTTCCCGTATTTATTTTAAATGTACGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8868
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
Genomic Location (Zv9):
Chromosome 4 (position 13741511)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14677364
GRCz11 4 14676119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
Long Flanking Sequence:
CAGGGCAAAATAATATTCAAGCTAAAAACAATGTAATGTGTTATTACATAATATTGACATTTTATTTTTGTTGTATTATTAAGATACAAGTTCAACATTACATAATATTGACATACTTTTTTATGTTATATTATTAATGCACAAGTACAACAGCATCATGCTTTTTCAGTTTATTAGATTCCATGGAAATTCAGTTTTCTGAAGTGAGAGAATTTGATAATTGGTTTAAACCCTGTAAACTGCTTCCCTTGAAATTTCCCTCCCTCAATCCATACTGTCATTTGCTGATTTGATAGTACATTAACTGAAGTTTTCTTTTTCTTCATCTTCACAGTATTTATGAATGCCGCCATTCCCATTGCTGCAGTGTTGGCGGTAAGAGATGCACAATCACAGGCTTTGATCCGGTTGTATTTTTTCCAGTGTGACCATACGCACTCTTGTTATTGTAGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCTCTATTCCACATCCTGGTCACTCCACTCTTCCTTTTGTCCACGGTTGTCAGGTTTGCCGTCAAGGCTCTTGTCAGGTATGTGGCTAAACTAAATCAGCAGTAAAATGTTACTTTGGAAGGATCTAATCATCTGATTGATGTCTGCAGTGTACAGAAGCTCAGCGAGTTCCTGCAAAGTGATGAGATTGGAGACGACAGCTGGAGAAATGGAGATATGTGCATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGATGTGAGTAGGCACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCATGGGTTCTGAAAAATTTGCTCTAATTTGCTCTTATTTAATATTAACCGCACCTAATGGGACTGGTTGACACAATATTTAAGTTACATAACAAGTCTTTTCTTGGCTTAATTTTGGAGACTCTCTGAGATCCACTCTGTCTTTTCCCGTATTTATTTTAAATGTACGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18175
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Essential Splice Site 645 1558 13 37
ENSDART00000079987 Essential Splice Site 557 1409 11 33
Genomic Location (Zv9):
Chromosome 4 (position 13741793)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14677646
GRCz11 4 14676401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATGTGYATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGAT[G/T]TGAGTAGGYACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCAT
Long Flanking Sequence:
TGCTGATTTGATAGTACATTAACTGAAGTTTTCTTTTTCTTCATCTTCACAGTATTTATGAATGCCGCCATTCCCATTGCTGCAGTGTTGGCGGTAAGAGATGCACAATCACAGGCTTTGATCCGGTTGTATTTTTTCCAGTGTGACCATACGCACTCTTGTTATTGTAGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCCAAGGCATTTGCCTCTTTGGCTCTATTCCACATCCTGGTCACTCCACTCTTCCTTTTGTCCACGGTTGTCAGGTTTGCCGTCAAGGCTCTTGTCAGGTATGTGGCTAAACTAAATCAGCAGTAAAATGTTACTTTGGAAGGATCTAATCATCTGATTGATGTCTGCAGTGTACAGAAGCTCAGCGAGTTCCTGCAAAGTGATGAGATTGGAGACGACAGCTGGAGAAATGGAGATATGTGCATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGAT[G/T]TGAGTAGGCACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCATGGGTTCTGAAAAATTTGCTCTAATTTGCTCTTATTTAATATTAACCGCACCTAATGGGACTGGTTGACACAATATTTAAGTTACATAACAAGTCTTTTCTTGGCTTAATTTTGGAGACTCTCTGAGATCCACTCTGTCTTTTCCCGTATTTATTTTAAATGTACGTTATTGCCATAAAGGTGTCAGAAAGTTATGCTACTGAATTAAACCTAATATTTTTTACATTTCCTACAAGCAGTAAAATCCCAGAGAAGGAAAACGTTATCAACCTAGGATGGTTAATTCCGTTGATTTTATTAGTCAGTGACTTTTTTTTCACTGAAAGAAACTAGAAAAAAATAAAATAAAATCAGTTTTACCTGAAAAAATAGACTTTTTCATCAACAAATAAAGATGGAATGAAAATGTTTATAGTGGGGCAATTTGTTAAATGATCCAGTCAGAACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 800 1558 18 37
ENSDART00000079987 Nonsense 712 1409 16 33
Genomic Location (Zv9):
Chromosome 4 (position 13756579)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14692432
GRCz11 4 14691187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAACCAGATATCGACCTCCTTCCTTTTGGAGACCAGACTGAAATCGGA[G/T]AGCGGGTAAGACTGTCTCTGGGCTTGAAACCAGCTCTCTGACCTCAGCTG
Long Flanking Sequence:
ATTTTTAATATTTTCATTACAAATCGCCTACGTTTCACATGACTTTCCAATCAATTCTCAATAGATGAAGTCTAAATGTAATTTTTTTACCTATATTCGTTTGAAATATGTCACATTACAGCCACATAATTGGTGAATGGATATTATCATTGATTTAACAAGGTGCTGTGAACTTGCCATTGTGGTTTGTAGCTTTACCACTGCTTTGAATTTAAATCTGTCAGCACTTACAGATGTTTTTTAAAGTTCGGCGGGTTGAAATTTTTACAATGCTCAGGGCCAGACCTCAGCTAAAATAAAACTCTCTTTGGAAACTCCGGGTCATGACTTTGCTCCCTAGAGAGCTCATGTTCGAGATTCCTAAGCTTTGGTTTTTTGAGGAGACGTTCTTTTATTTTTAAACTTTAAATTTGTTGGACAGATACAAAGCTGTGATTGATGCCTGCTCGCTTCAACCAGATATCGACCTCCTTCCTTTTGGAGACCAGACTGAAATCGGA[G/T]AGCGGGTAAGACTGTCTCTGGGCTTGAAACCAGCTCTCTGACCTCAGCTGCCGTGATGCTAATTGAATAAAGACCTGTTATTGAAACTACCATGACTATTGCATTACGTCATCAGAATCAAAAGTGTTTAACTTGTGTTTGTGTGTTGTAACCCAACAGGGTATTAATCTCAGCGGTGGTCAGAGACAGCGGATCTGTGTGGCCAGAGCTCTGTACCAGAACACCAACATTGTTTTCCTGGTAGGAACAAACTTATGGTGTCTTTCCTCCACCCTGAATAAGTGATATGCCACATGATTGAAATGTTATGAATGACCGCAGCTTTTAATTTGATTTTAGAGGTACTCCCAAGTTGAGATTTCTTAACTGACACATGATAGCACAGGGTACGTTGTGGCAGCGATCGCAGAAAACACAGTGATGTGTAAGGACTGTTATTGGATTACTGGACATAACTACACACCCTTCTGGACAGGATCGTGAATTCATCTCATTCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38431
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 1454 1558 35 37
ENSDART00000079987 Nonsense 1265 1409 30 33
Genomic Location (Zv9):
Chromosome 4 (position 13775614)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14711467
GRCz11 4 14710222
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTCATGCTTTATGTTTGACTTTCGTCCCGCAGACGCTGTGGTGACCGAA[G/T]GAGGAGAGAACTTCAGTGTGGGACAGAGGCAGCTATTTTGTCTCGCCCGG
Long Flanking Sequence:
TAATGACACTTCTATATTACATTTGCCAGTTTTGTAGCTTGACAACCCTAAAAAAAAAGTGCAGCATGAACATTCTATCAAACATCTCCAAATGTCTCTCTCTAAAAAAACTGTGTTTATAGAAACATGAGTTCATCAGCTGTCTATATATGCACTTTCTATAGGTTAAATCTAGACCCCGAGCGCACATGCACCGACGACCGGCTTTGGGAAGCTCTAGAAATCGCTCAGCTGAAGAATATGGTGAAAGCTCTTCCAGGAGGATTGGGTAAGAGCAACAACACACGCCCTCCGAAAACATTCAGCTCTTATCCAGCAGAATGTCAGTCACCTCCTGGTTTTGACACTCACTGGAAATTCTCTACTGAAACGCTGGAGTTTTCTGACCCTTTGACAATGAGTTTGATTTCTGAGGAAAGCGATATTGAGTAAATGTGAACAGCTGTTGGTGGTCATGCTTTATGTTTGACTTTCGTCCCGCAGACGCTGTGGTGACCGAA[G/T]GAGGAGAGAACTTCAGTGTGGGACAGAGGCAGCTATTTTGTCTCGCCCGGGCCTTTGTTCGCAAGAGCAGCATCCTAATAATGGACGAGGCCACAGCTTCTATTGACATGGCCACGGTATAATCACAGATACAGAGGCTCATTTTTTACGACATGAGGAAAACAAATCATGCTTTGTTAAATCATGGCTATGCTAAAGTCACATTTAAAAAAAAAAAAAAGCCATTTTGTGATTAAAAAGTGACATTTTAATAGATTAAAATTAATATTCTTAATATAAATGTAAAAAAAAGTCTAAATTATTTTATAACAAGGTGTGGAATTTACAAATATTTGACAAAAAGTCTTAAATTTCAAACAAAAAGTGATGATTTTGACATACAAATTCATAATTGAAATAGAGGAATTATTGATTTATTTATTAATAATTTAAGCTAGCATATTTTAAGGAGATTTGTATCAATTATGATCATTGAAATTATGATAAACATTGGGAAAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5254
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 None None 1558 None 37
ENSDART00000079987 Essential Splice Site 1365 1409 33 33
Genomic Location (Zv9):
Chromosome 4 (position 13779026)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14714879
GRCz11 4 14713634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCAYCCRCTTAAGCACTGTTTGACCATACAGAGATATGTATTTTCTGC[A/T]GCATCGTGTGCACACAATCCTGACGGCGGATCTAGTGATCGTGATGAAGA
Long Flanking Sequence:
TTACTGACATTTAGGTATGGCAATCAAAATCCAACATCTGATAGACATCGTTTTGGTAACGTTCACACAGTGTCAAGCTGCAACATCATTAAACATTGATATTTTGTTGTTATTAGGTTTCGTTGGAATGTAACCAAAATGCAACGTCTATCCAACATTGGACATTGACGTCGGCCTGATGTTGAGTTCTGACGTCAACCCGATTTTAATTATTAATTAAAATGTGACGTCCCATGACGTTAGGGTACAACATCAATCTGAAGTCAGGTTGACGTCCTGTGCCTGCTGGGATGTTTATGTGGTGTGTTGCTTGATGTTTTATTAAGAAATTAATTTAATGATTTCATTCATAATGCATTTTACTTTATTTCAATAGTGTTATTTATTTATTTATAATTAAAAATATTCAGTTATATACTTGAGAATCAAAAGGTGAAGCTCTAAATATAATCTCATCCGCTTAAGCACTGTTTGACCATACAGAGATATGTATTTTCTGC[A/T]GCATCGTGTGCACACAATCCTGACGGCGGATCTAGTGATCGTGATGAAGAGAGGAAGCATCATGGAGTATGAAAAACCCGAGATCCTCATGGAGCAGGAGGACGGCCTGTTTGCATCTTTTGTCAAAGCCGACATGTAAAAATCCCCACTTTACACCACTTTTGGCCTTAACAGATCAATAAAAGCCATTTTTACCAGTGCGCTGCCATTGGAAAGGACTCAACTACACACAGACTGTGAACTGTTATCCTTTTATATGAATCTGATTTACAGTATTTTAAGCGTTTTGTTAGCATACGGCTCTTTTTGTAAGGTAATGACGCGTGTATTTAGAAACGCATAAGCAATAAGCATTTATCTACTGTGTTTTTGACTAGTATCAACACTGTTGGGAGCGAGGCATGATGCTCTCGTCCATCTGTCTGTCTGAAGTGCATTGCTGATCCAGATTTAGGGAAAGAATGGTGGCTGTGAATACACCAGAGTGACCCTAATGTGTT
Associated Phenotype:
Not determined