Busch Lab

ZMP

TSHZ3 (1 of 2)

Ensembl ID:
ENSDARG00000015959
Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Human Orthologue:
TSHZ3
Human Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Mouse Orthologue:
Tshz3
Mouse Description:
teashirt zinc finger family member 3 Gene [Source:MGI Symbol;Acc:MGI:2442819]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa7083 Nonsense Mutation detected in F1 DNA Not yet available
sa40987 Nonsense Mutation detected in F1 DNA Not yet available
sa34161 Nonsense Mutation detected in F1 DNA Not yet available
sa15444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 299 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48341314)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46459425
GRCz11 7 46731791
KASP Assay ID:
554-5130.1 (used for ordering genotyping assays)
KASP Sequence:
TGGCAGCCAAGATTATCTCCTCAGCTCGTAAAAGAGCCCCTATTGAGCTA[G/T]AACTCCCCAGCTCACCAGATTCTAACGGTGGCACCCCCAAGCCTTCTTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27026
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 362 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48341125)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46459236
GRCz11 7 46731602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGGCAGTTTGAGTCGCGAAAATCCCAGATCCTGAAGTGCATGGAGTGT[G/T]GAAGCTCACATGACACATTACAGGAATTGACCGCCCATATGATGGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40987
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 481 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48340766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46458877
GRCz11 7 46731243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCAGCAGAAAGCGAAACTGATGAGAAGTTTGAAGTTTCATCCAAGTA[T/A]CCATATTTGACAGAGGAAGATCTTGAAGAAAGCCCTAAGGGGGGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34161
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 920 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48339450)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46457561
GRCz11 7 46729927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGCAAGTACATTATGTCAGACCTCAGTCCACAGGAGCGCATGCATATTT[C/A]GCGCTTTACTGGACTCTCAATGACGACCATTAGCCACTGGCTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 1028 1066 4 4
Genomic Location (Zv9):
Chromosome 7 (position 48339059)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46457170
GRCz11 7 46729536
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCCCTCCCCTTCCCCAGATGWGGAGGCAAATGGCACCTCRTATCAGTG[T/A]AAACTGTGTAATCGGACTTTTGCCAGCAAACACGCCGTCAAGCTCCATCT
Associated Phenotype:
Not determined