Busch Lab

ZMP

stat6

Ensembl ID:
ENSDARG00000015902
ZFIN ID:
ZDB-GENE-030131-9359
Description:
signal transducer and activator of transcription 6, interleukin-4 induced [Source:RefSeq peptide;Ac
Human Orthologue:
STAT6
Human Description:
signal transducer and activator of transcription 6, interleukin-4 induced [Source:HGNC Symbol;Acc:11
Mouse Orthologue:
Stat6
Mouse Description:
signal transducer and activator of transcription 6 Gene [Source:MGI Symbol;Acc:MGI:103034]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24352 Essential Splice Site Available for shipment Available now
sa24351 Essential Splice Site Available for shipment Available now
sa9252 Nonsense Mutation detected in F1 DNA Not yet available
sa37727 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24352
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 93 758 4 21
ENSDART00000059346 Essential Splice Site 87 674 4 26
ENSDART00000139231 None None 470 None 14
ENSDART00000146467 Essential Splice Site 93 272 4 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27351294)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27184116
GRCz11 23 27110657
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTCCCTCCTCTTTTTGATGTAACCTGCTGAATTGTTTCTGTGCTATA[G/A]AGTGTGCTTTACCCACAACCCTTACAACTTGTGAGGACAGTTCGGGAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19327
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 179 758 5 21
ENSDART00000059346 Essential Splice Site 173 674 5 26
ENSDART00000139231 None None 470 None 14
ENSDART00000146467 Essential Splice Site 179 272 5 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27350903)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27183725
GRCz11 23 27110266
KASP Assay ID:
554-6194.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTCATCAGCTTCAAGAGGAACTGAATTGGGAGAAAGAGACGATTCAAG[G/A]TATGAAGTCCAAGTTGTTTTGTCAGCTTGTGGCAAAAATAATGACTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24351
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 528 758 13 21
ENSDART00000059346 Essential Splice Site 519 674 17 26
ENSDART00000139231 Essential Splice Site 240 470 6 14
ENSDART00000146467 None None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27330850)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27163672
GRCz11 23 27090213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGAGATTTCGAAAACATGCTTGTTTCCTGGGCTCAATTCAACAAG[G/A]TAACACTAACATGCAATTTACATATCGTATATGTTCATTAATATATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9252
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Nonsense 554 758 14 21
ENSDART00000059346 Nonsense 545 674 18 26
ENSDART00000139231 Nonsense 266 470 7 14
ENSDART00000146467 None None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27329052)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27161874
GRCz11 23 27088415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTCTGGCAGTGGTTTGAAGGGGCAATAGACCTAACTAAGAGATGCCTA[C/T]GAGAYTATTGGACAGATGGGTAAAGTTGCAATTACTTAAGTTTCTTTTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8018
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 675 758 17 21
ENSDART00000059346 Essential Splice Site 664 674 22 26
ENSDART00000139231 Essential Splice Site 387 470 10 14
ENSDART00000146467 None None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27326304)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27159126
GRCz11 23 27085667
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTAATGCTGATGGATACCTGCCTTTYAAGCTTACAACAGTTGTCAACCC[G/T]TAAGTATTTATTTTRCTGTAAAATTTCCAAAGATTTTATTTTATGTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37727
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 707 758 None 21
ENSDART00000059346 Essential Splice Site None 674 None 26
ENSDART00000139231 Essential Splice Site 419 470 None 14
ENSDART00000146467 None None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27326053)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27158875
GRCz11 23 27085416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATGAATTTTATTTCACCATCTACGTCTCAGGCATTTGGGCAAAACATG[T/A]GAGTATTGAAGTAATTCTATATTTGTATTTTTCTATAAAGCCAGAAATTG
Associated Phenotype:
Not determined