Busch Lab

ZMP

npas3b

Ensembl ID:
ENSDARG00000015876
ZFIN ID:
ZDB-GENE-060503-934
Description:
Novel protein similar to vertebrate neuronal PAS domain family [Source:UniProtKB/TrEMBL;Acc:Q1LXP7]
Human Orthologue:
NPAS1
Human Description:
neuronal PAS domain protein 1 [Source:HGNC Symbol;Acc:7894]
Mouse Orthologue:
Npas1
Mouse Description:
neuronal PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109205]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45530 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6365 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45530
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101511 Essential Splice Site 165 770 5 11
ENSDART00000140213 Essential Splice Site 165 448 5 10
Genomic Location (Zv9):
Chromosome 15 (position 8517354)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8466861
GRCz11 15 8442932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAAATGAAGGCATTGATCCGCGCGTTTGTTTGTGTGTGTTTGGATGCTC[A/G]GGTGGAGTTGACTGGCAGCAGTGTGTTCGATTACATCCACCCTGCGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6365
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101511 Nonsense 551 770 11 11
ENSDART00000140213 None None 448 None 10
Genomic Location (Zv9):
Chromosome 15 (position 8501303)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8450810
GRCz11 15 8426881
KASP Assay ID:
554-4528.1 (used for ordering genotyping assays)
KASP Sequence:
ACCACAATCCCTCCAGCAAACGGGTGAAGAATGAAGAGGGGGCTTCAAAA[C/T]AAGGCAACGGGGCTAACGGAGCAGGTAAGATCCACAATGGCCGTGCTGTG
Associated Phenotype:
Not determined