Busch Lab

ZMP

si:dkey-185l3.3

Ensembl ID:
ENSDARG00000015869
ZFIN ID:
ZDB-GENE-041001-166
Description:
solute carrier family 22 member 16 [Source:RefSeq peptide;Acc:NP_001020659]
Human Orthologue:
SLC22A16
Human Description:
solute carrier family 22 (organic cation/carnitine transporter), member 16 [Source:HGNC Symbol;Acc:2
Mouse Orthologue:
Slc22a16
Mouse Description:
solute carrier family 22 (organic cation transporter), member 16 Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17584 Essential Splice Site Available for shipment Available now
sa23738 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007688 Essential Splice Site 17 565 2 9
Genomic Location (Zv9):
Chromosome 20 (position 31315337)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31386550
GRCz11 20 31289429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTATTCAGTCARTAAYTAATTTCCAAWTTAACCTTCTACTTTCTCTTC[A/G]GGTTTCAGGCATGCCTCTACTTTGCTGCAATTTTCCAGGCCATCTCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007688 Nonsense 389 565 5 9
Genomic Location (Zv9):
Chromosome 20 (position 31319630)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31390843
GRCz11 20 31293722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATACTACGTCTTTAGCCTGGGCTCTGTCAACTTGGGAGGAAACCAGTA[T/A]ATCAACCTCTTCTTGGCTGGTAATGTGACTAATGTGTGCGCATGTATTGA
Associated Phenotype:
Not determined