Busch Lab

ZMP

zgc:152969

Ensembl ID:
ENSDARG00000015749
ZFIN ID:
ZDB-GENE-061110-115
Description:
Hermansky-Pudlak syndrome 3 protein [Source:RefSeq peptide;Acc:NP_001180471]
Human Orthologue:
HPS3
Human Description:
Hermansky-Pudlak syndrome 3 [Source:HGNC Symbol;Acc:15597]
Mouse Orthologue:
Hps3
Mouse Description:
Hermansky-Pudlak syndrome 3 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2153839]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6717 Nonsense Mutation detected in F1 DNA Not yet available
sa10831 Nonsense Available for shipment Available now
sa43887 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 165 1003 3 18
ENSDART00000059690 Nonsense 165 524 3 11
ENSDART00000140968 Nonsense 209 1042 3 18
Genomic Location (Zv9):
Chromosome 22 (position 41180586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38268225
GRCz11 22 38221372
KASP Assay ID:
554-5220.1 (used for ordering genotyping assays)
KASP Sequence:
RTCTTCTRGTGGGGAGTGCCAAGAGTCTGGTGGTCTTCAGTCTGAAGCGG[C/T]AGACTCTGAGCGAGCAGYTGTCGGTGCTGGACTTCGAGAGAGTTCTGATA
Long Flanking Sequence:
ACAACACTACTACAACACCACTACTACTACACTACGACATCTCTACAACACTACTACAACACCACTACTTCAACACTACGACATCACTACAACACCACCACAACACTACTACAACACTACAACACTACTACAACACTAGAACACCACTAGTACAACACTACAACACCACAAAAACACTACTGCAACACTACAACAACACTACTACAATGCTACAACAACACTACTACAATGCTACAACAACACTACTACAACACTACAACAACACTACTACAATGCTACAACAACACTACTACAATGCTACAACAACACTACTACAATGCTACAACAACACTACAACAACACTACTACAATGCTTCTACAACATTACTACAACACTACTACAATACTGCAACAACACTACTACAACACGAGCATAGTATCTCTTCCAAACTGAGTGTTCTGTGGCAGGTGATCTTCTGGTGGGGAGTGCCAAGAGTCTGGTGGTCTTCAGTCTGAAGCGG[C/T]AGACTCTGAGCGAGCAGCTGTCGGTGCTGGACTTCGAGAGAGTTCTGATACTGCATATCCAGGGCTGGAGCCCATCTCAGGTGGCCTTTTGTGCGGGATACCTGGCCCTGCAGACAGAGCTGGAGGTGCTGGTCATAAAGCTGGTCCAACAGCAGAAGAGTGCTCAGACTGCTGAAGAAAACGCTCTGCTTCCTGTAGATATCATGGTGGAGACCAGCTTAGAGGACGATGCAGGTATTGCTGCACGCCACCAGTAACAACATATCTAAAGTGCTCCTATTATGCATTTATTTTAATAAAAAATATATTTTCTTAAGTTTATAGTTTGGATATGGGGGTCTCCAACAATGTGAATGCAAGATCAAAAACTCTTTGTCTTAAAATTTGCATTTATTTTTACAAAATTACCCCAACGATTCCCATACGATTCGTTCAGCAATTCATTTTTCCAAACACCTCCTTTGCATGAGGCTAATCTGCTGTGATTGGTCTGATGACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29844
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Essential Splice Site 330 1003 5 18
ENSDART00000059690 Essential Splice Site 330 524 5 11
ENSDART00000140968 Essential Splice Site 374 1042 5 18
Genomic Location (Zv9):
Chromosome 22 (position 41178155)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38265794
GRCz11 22 38218941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGAGGAGACACGCTTGCACTCCCTACAGCTCCACCCGATATTTACTGG[T/G]ATGTGTTTGTAGGAAACAGTGATGGATGTGTACTTTAATTTGATTTGTTT
Long Flanking Sequence:
TTTGTCCAAGAAGTAGATTTTCTGCCACTAAAGGGGTTTTGAAAGACGTTAAATTGGCAACACTGATTTGCAGTACTGCACATAATTCAACAGCAACATGCACGTGTCCTGAACTGTAATCGGCACACATTTATCCCTCCGTATTCTCCTGCAGAGATGAAGAAAGACGGCTTCAGCCCGCTCCATGAGCAGGAGGACTTCTTTGTGTTTCCTAAGCACCAGGAGATGCTGGGTTCTGAAGCGCAGCACTGCGGGATCACTTTAGTCCCAGAGTGTACAGCTATGGACTCTGAAAGTCGAGGAGAAACCACTGTGGTTTACGTTTTATTCAGGTATGCAGAAAACCTAACAGAAGCGGGCCGTGTTCTCATTGTGTGGTGTTTTCTAGATATCACCTCTTTCTGTTCTCTCTTTAGGAGGTTTGCGCCTGATTTCTTCCAAGGCTGCAGCGTAGAGGAGACACGCTTGCACTCCCTACAGCTCCACCCGATATTTACTGG[T/G]ATGTGTTTGTAGGAAACAGTGATGGATGTGTACTTTAATTTGATTTGTTTATTTGTCCCAGGACAGATTGTTAAAATGGTCATCCCAAAAACAACACCAAAATTTACACAATGAATCAAGCACAACTAAGAAACACTAAAATAGACAGTTAAATAGATCTGGATATATGTAAACAAAATAAACTAAAACACCAACATTGCGTAAAGAAGATAAGAGTAGTTAAAACTAGTGGTGTAACGGATCACAAATCTCACGGTTTAGACCACGTAAAGGGTTTTAGTTTAGTTTTAGACAGTTGACGGGACAGTACACATCGAGTCTATGTCAAGTGCAATATAATTACAGTGGAAAATGAAAAAAAAAAAAAAAAAGAAATATATATATATATATATATATATATATATATATATATATGTAAGATGACCTTAAATGTAATTATAGTATCTCATTACACTCAACTAACACTGAACACGTTACATGCTGTCGCACACCCCTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10831
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 361 1003 6 18
ENSDART00000059690 Nonsense 361 524 6 11
ENSDART00000140968 Nonsense 405 1042 6 18
Genomic Location (Zv9):
Chromosome 22 (position 41177528)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38265167
GRCz11 22 38218314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTATGTTTGTTTTCTTCTCCTTGCCCAACACCGGCTACATGTACAGCT[T/G]AAAGTCTTCAGTGGAGCTCGTGTCCACATACCAGTACCCAGAAAAGGCCC
Long Flanking Sequence:
TAAGAAACACTAAAATAGACAGTTAAATAGATCTGGATATATGTAAACAAAATAAACTAAAACACCAACATTGCGTAAAGAAGATAAGAGTAGTTAAAACTAGTGGTGTAACGGATCACAAATCTCACGGTTTAGACCACGTAAAGGGTTTTAGTTTAGTTTTAGACAGTTGACGGGACAGTACACATCGAGTCTATGTCAAGTGCAATATAATTACAGTGGAAAATGAAAAAAAAAAAAAAAAAGAAATATATATATATATATATATATATATATATATATATATATGTAAGATGACCTTAAATGTAATTATAGTATCTCATTACACTCAACTAACACTGAACACGTTACATGCTGTCGCACACCCCTGTTTTCCACTCAATGGTTTCCTCCGTCTGATTGAACAGGTAAACAGGAAGAATCCTCCATCTCCAGATGTGGGGATCCTGATTGTATGTTTGTTTTCTTCTCCTTGCCCAACACCGGCTACATGTACAGCT[T/G]AAAGTCTTCAGTGGAGCTCGTGTCCACATACCAGTACCCAGAAAAGGCCCACCAGGCTGTGCTTAGTGACCAGTTCCTCTACGTCATCACCAGGTAGATTGTTCAGACTCTGTCCATACACACGCACACACACACACAGCAACTTTTGATAATTAACGGTCCCATAAAATTAAGACCAGTCACACAAAAAGTAATATATATATATACATTTTATTATATATAAATTTAAACTAGCATTTTTTACAATACTGCCATGCATATATTTCATTCATTCATTTGCCTTCGGCTTACTCCCTTATTTATCAGAGGTTGCCATTGTGGAATGAACCACCAATTATTCCAGCATATGTTTTACACAGCGGATGCCCTTCCAGCCACAACCCATTACCAGGAAACACCCATACACACTCATTCACACATACACTACGGCCAGTTTAGTTCATCCAGAGAACATGTAACTGACCCAGCCGGGACTCAAAGCAGTGACCTTCTTGCAGTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7993
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 402 1003 7 18
ENSDART00000059690 Nonsense 402 524 7 11
ENSDART00000140968 Nonsense 446 1042 7 18
Genomic Location (Zv9):
Chromosome 22 (position 41176552)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38264191
GRCz11 22 38217338
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGTGTGTGTTTGTGTAGGAACGCTCTGCAGTGTTTCACCGTCAGATG[C/A]AGTGCAGTAGCAGCTYGGGTTCAGGACCCSTACATCGACACCACCATGAA
Long Flanking Sequence:
CAAAGCAGTGACCTTCTTGCAGTGAGGCGACCACTAAGCCACTGTGCCGCCAATGCATGTATACACAAAAATATAGACAGTAAACACAAATATTCATTCATTAATTTTCTTTTCGGCTTAGTCCCTTTATTAAACAGGCATCGCCACAGTGGAATGAACCGCCAACTCATCCAGCATATATTTCACACAGCGGATGCCCCTCCAGCTGCAATCCATCTCTGGGAAACATCCATATGCACTCATTCACACCCGTACACTACGAACAATTTAGCCTACCCAATTCACCTGTACCGCATGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACATAAACTCCACACAGAAACGCCAACTGACCCAGTCAAGGCTCGAACCTTCGTGCTGTAAGGTGAACGTGCTGCCCACTGCGCACTGCTTTAAGTATAAATGAGAAAAGGTTGTGTGTGTGTTTGTGTAGGAACGCTCTGCAGTGTTTCACCGTCAGATG[C/A]AGTGCAGTAGCAGCTCGGGTTCAGGACCCCTACATCGACACCACCATGAAGGTAACGCAGCTCAGCACACACATCTCTGCTCTTGCATTACTTTGTTTTAACTCGGGTCCAAAGTCCTCTTTGGTTTTCAGGCACAGAGTAAAGCCTGGTTGATACTTCTGCGTCGAGTGATCGGCGTGACCCACAGCGCATGCAACGCGTGTATATGTGCATTCATACTCCTGCGCTGTTTCTGTTGCTCTGCAGTAACACTTCTGAAACAGTAGTTGGCAGTGAGGTGTTTATGTTCCTCTGTGTCGAGTTTCTGCGCTGTTGTTTTGTTTTTTCTAAACGCTACCTTAATGTACAAGGGGTTCAAGCTTGCTCATTAGCACAGCTCTTATCACTGAATCCAAATGGGAAAAAGTTAGCAAACTAACAAAACGTTTTTCCAATTATGGAAAGTGGAAACATACAATAGAAAATATTAATAAATATAAATATGTAAAATATAATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Essential Splice Site 419 1003 7 18
ENSDART00000059690 Essential Splice Site 419 524 7 11
ENSDART00000140968 Essential Splice Site 463 1042 7 18
Genomic Location (Zv9):
Chromosome 22 (position 41176499)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38264138
GRCz11 22 38217285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTAGCAGCTCGGGTTCAGGACCCCTACATCGACACCACCATGAAGG[T/C]AACGCAGCTCAGCACACACATCTCTGCTCTTGCATTACTTTGTTTTAACT
Long Flanking Sequence:
TGCATGTATACACAAAAATATAGACAGTAAACACAAATATTCATTCATTAATTTTCTTTTCGGCTTAGTCCCTTTATTAAACAGGCATCGCCACAGTGGAATGAACCGCCAACTCATCCAGCATATATTTCACACAGCGGATGCCCCTCCAGCTGCAATCCATCTCTGGGAAACATCCATATGCACTCATTCACACCCGTACACTACGAACAATTTAGCCTACCCAATTCACCTGTACCGCATGTGTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACATAAACTCCACACAGAAACGCCAACTGACCCAGTCAAGGCTCGAACCTTCGTGCTGTAAGGTGAACGTGCTGCCCACTGCGCACTGCTTTAAGTATAAATGAGAAAAGGTTGTGTGTGTGTTTGTGTAGGAACGCTCTGCAGTGTTTCACCGTCAGATGCAGTGCAGTAGCAGCTCGGGTTCAGGACCCCTACATCGACACCACCATGAAGG[T/C]AACGCAGCTCAGCACACACATCTCTGCTCTTGCATTACTTTGTTTTAACTCGGGTCCAAAGTCCTCTTTGGTTTTCAGGCACAGAGTAAAGCCTGGTTGATACTTCTGCGTCGAGTGATCGGCGTGACCCACAGCGCATGCAACGCGTGTATATGTGCATTCATACTCCTGCGCTGTTTCTGTTGCTCTGCAGTAACACTTCTGAAACAGTAGTTGGCAGTGAGGTGTTTATGTTCCTCTGTGTCGAGTTTCTGCGCTGTTGTTTTGTTTTTTCTAAACGCTACCTTAATGTACAAGGGGTTCAAGCTTGCTCATTAGCACAGCTCTTATCACTGAATCCAAATGGGAAAAAGTTAGCAAACTAACAAAACGTTTTTCCAATTATGGAAAGTGGAAACATACAATAGAAAATATTAATAAATATAAATATGTAAAATATAATAATATATTGCATTGCCAGCTTTTAGAAGAGTCACTCCACCAGATCTCATTGTTCTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29843
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 567 1003 10 18
ENSDART00000059690 None None 524 None 11
ENSDART00000140968 Nonsense 606 1042 10 18
Genomic Location (Zv9):
Chromosome 22 (position 41171146)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38258785
GRCz11 22 38211932
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCTGCTGGAGGCCTTTCAGGAGAGCTGCGCTCATTTAGGAGACTG[T/A]TTCAGCAGGTCAGCTGGAGAGCTGGGCAAAAAATATATAGATTTCTCAAC
Long Flanking Sequence:
TTTTGCCTTTGGAAGACTATTGTAAGCAGTTATATTGTCATATATTGTAATTGTTGTGCCTCAGGTGGAGCACAGGAAGCAGATATTGTTATATTTGCCATAGTTTGATCTTAGATTGAGTACTGAAAGCTGTTTTATTGTCAAGTTTTGTCATTGTTTTGTCTCAGGTTGGGTATAGTAAGCAGATGTTGACATTTATTTTCAATGTTTTGCCTCAGGAGGTGTACAATAAGCAGATATTGTCATATTTGTAATAGTTTTGTCTTAGATTGAGTACTGTAAGCTGTTATATTGTCATGTTTTGTCATTGTTTTGTCTCAGGTGGAGTACAGTAAGCGGTACGAGCAGTCCAACCCGTGTTCACAGAGCTGTGTTCATCTGCTCAGTGAAGCTCATCTTCTTCTGCGGTCAGCGCTGCTTAAACTGCAGAACGGCCCTGCTGAGGAGAAGCAGGAGCTGCTGGAGGCCTTTCAGGAGAGCTGCGCTCATTTAGGAGACTG[T/A]TTCAGCAGGTCAGCTGGAGAGCTGGGCAAAAAATATATAGATTTCTCAACTAATTGTGTTTTTTAAACCATGGTGGATTCTCAAAAGCCGTCAGTTAATCTTTTCTCATAGATTTTTTACATTATTTATTTATTCATTGATGTCTGTAATCTAGAACTGTCAAATTTAGATGAAAATCATCAAAAATGCTGATAGTAAAAAAAATGGCGCCAAGCAGTCAAAAACACAAAGCTGACAGAAACAGCTGATGGAGTATACACTAACCTGCGCATTATTCAGACACTAGATGTAGAAATATATATATATATATACACACACATACAAATATATATAAAAACATAAAAAAGTTAATGTGTTTTCTGACGGTCAAGATAATCCTCAGTTTCCGGATGATTCTGTGTTATTTAGCAGTTGTTATCTGGGAGTAACATACCTTAAAATGACCAATCAGAAGTGAGTATTGCAGACAGCTGTGTAACAATGCTGTTTTATAATGTGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29842
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Essential Splice Site 936 1003 None 18
ENSDART00000059690 Essential Splice Site 492 524 None 11
ENSDART00000140968 Essential Splice Site 975 1042 None 18
Genomic Location (Zv9):
Chromosome 22 (position 41164161)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38251800
GRCz11 22 38204947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGCCATCATCCCATACGCACAACACCAGCTGCACCACCACACACTGG[T/A]AACACACTCACACACACTTATGACATCTCCAACCAGTCGATTTGATCGTC
Long Flanking Sequence:
ATCCATTCATTCATGCATTCATCCATCCATCCATCCATCCATTCATCCCTCCATCCATCCATTCATCCATCCATCCATCCATCCATCCATCCATCATATATTCATTGGAAAATAGAAAAAATACACATTTTTAAAGGGGCATCCACATTTTTGCTGAACATTTTGTTAGAAGAATAACCAGAAATAAAGACTCAACAATAGACAGAGCTACGATGAGTAAACTCTGTTTTTCCCATTTGGTTTGCTTTAAAATGGTCCCATGAGGTGTGATTGATTGTGTTTGTGTGTTCAGTCTCTGCTGTGCGGGCCGACGCTGCAGGTCTCCTCTATTCTGCCTCTGCTGGAGCCGCTGTCAGACTCCGATGACCCAGGACTTAGTGTTCATGTGCTCTGCTCCACCAAACTGGGCCAGCATGAGGACTCCATCCACAGACTGCTGGACCGCTGCCCACAGGCCATCATCCCATACGCACAACACCAGCTGCACCACCACACACTGG[T/A]AACACACTCACACACACTTATGACATCTCCAACCAGTCGATTTGATCGTCTGAGACAAATTTGGGAAAGTCTTCCATGCAGGGAAATCTCCTCAGTGTTTGGATAAATATGCATTCAGAATGGTCAAACACTTCTTTATAGAAGTTCACATTGTTGAAGATTAAATATACACAACAATATTTAATATTAATATACAGTCAGGCCCATAAATAATTGGACATGGACACAAGTCTAACATTTTTGGCTCTACACACCAACACAACGGATTTGAAATGAAGCAAATGTGCTTTAACTGCAGACTGAAAGCTTTAATTTGAGGGTATTTACATGCAAACCAGATGAACGGTGTAGGAAATAAGTGTGCTTCCCACTTGTTAAGGGACCAAAAGTAATGGGACAATTGACTTCCCAGCTGTGCCATGGCCAGGTGTGTGTTATTCCCTCATTATCTTAATTACTTTGAGCAGATGACAGGTCCAGAGTTCATTTCAAGTGTGCTG
Associated Phenotype:
Not determined