Busch Lab

ZMP

ANO5 (2 of 2)

Ensembl ID:
ENSDARG00000015731
Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Human Orthologue:
ANO5
Human Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Mouse Orthologue:
Ano5
Mouse Description:
anoctamin 5 Gene [Source:MGI Symbol;Acc:MGI:3576659]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25238 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa38139 Nonsense Available for shipment Available now
sa24725 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30303
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Essential Splice Site 275 915 8 20
Genomic Location (Zv9):
Chromosome 25 (position 36282591)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34716331
GRCz11 25 35221289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATAAATGACGAGGCATTATAAGCTGAATCTTGTGGCTCCTGTCTCGC[A/C]GGAAGTACTATGGAGAGAAGATCGGCATCTACTTTGCTTGGCTGGGTTTT
Long Flanking Sequence:
GGTCATCAGTTCACCAAACTCACCGCTGTTTACTGAGTGTAACCACAGATACAGGGACACTGGAGCTTTTTAAAGCCGTGATTCATCAGCGGATCTTTTGTATGTCAGCTTCTATACAAACCAGCTGATCGACGCGACTTTAAAAACGCTCCAGTGTCCCTGTACACTTGCCGGCAGCTAGCTCTCTGCAGCTCTCATATGGTCGACTACTGAAGCTAAGCAGGGCTGCGTCCTTTCAGTACCTGGGAGACCACATGGAAAAGTCAGGTTGCTGTTGGAACTGGTGTTAGTTAGGCCAGCAGGGGGCGCTCAACCTGCGGTCTGAGTAAGTTCTAATGCCCCAGTATATGACCGGGACTCTATACTGCTCAGTGAGCGCCGTCTTTCAGATGAGATGTTAAACTGAAGTTCTGACTCGACTCTGTGGTCGTTAAAAATTATTATTCTTACTTAATAAATGACGAGGCATTATAAGCTGAATCTTGTGGCTCCTGTCTCGC[A/C]GGAAGTACTATGGAGAGAAGATCGGCATCTACTTTGCTTGGCTGGGTTTTTACACGGAGATGCTGTCCTATGCTGCGGTTGTGGGTTTACTCTGCTTCATCTATGGAGTGGCCACCTTTGACGAAAACATCTGGAGGTGAGGATGATAAATGGTACAAAAGTATAAAAGCTAAACATTAAGGACAGTTTATCAGTGTCGTGGAGCGGTACTGACTTTAAAAAGAGTTTTGATTTGTCTTCAAAAACCTACATATGACAAGATATATAAACTGTTATTGCAATATTACACTTTTGTAAAATGTTTGATGGTCATTATTTTTTGGTTCTGGAAAAAAGATGAGCAGAACATATTCTCCTCTAGATTTTGCTTATTTGATCACAATAAAATATGATCATGCCTTGATGTTGAATGATTTCATTAGGACAGTAAGGTTTGACTCTGCTTAGGCTAAAGTCTCATCACTGAACAGGAATAATGTCCAGTATAGAATATAAAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Splice Site, Nonsense 321 915 9 20
Genomic Location (Zv9):
Chromosome 25 (position 36284901)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34718641
GRCz11 25 35223599
KASP Assay ID:
554-7529.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATAAGACGCACACAGGGAATAAACAAAAGTGATTGTCGTCTTCCGCAGT[C/T]GAGAGATCTGCAACGAGACCATCGGTGGGCAGATTGTCATGTGTCCGCTC
Long Flanking Sequence:
TTACTGTCGCCTTTCTATCAGCTGGAACCAGTCTGGCCATTCTCCTCTGACCTCCAGCATCAACAAGGCATTTGCATCCACAGAACTGCCGCTCACTGGATATTTCCTCTTTGTCAGACCATTCTCTGTAAACCCTAGAGATGGTTGTGCGTGAAAATCCCAGTATATCAGCAGTTTCTGAAACACTCAGAGCAGCCCGTAAATCTCCTTTCTTCCCGATTCTGATTCTCGCTTTGAGCTGCAGCAGATCGTCTTGACCATGTTTAAATGCCTAATTACCTTAATCTGCTGTCATGTGATTGGCTGATTAGAAATTTGCGTTAACAAGCAGTTGAACAGGTGTACCTAATAAAGTGGCCAATGAGTATATATAACTTTAGCAAAGTTTTGAGAATGCAGCCGACCTGAAATGCCCATTTCAGAAGCACAAAAAGTCTTGCATCATGAAGGCATAAGACGCACACAGGGAATAAACAAAAGTGATTGTCGTCTTCCGCAGT[C/T]GAGAGATCTGCAACGAGACCATCGGTGGGCAGATTGTCATGTGTCCGCTCTGTGATAAGAAATGCGGCTACTGGAAGCTCAGCACTACCTGCAGCTCTTCATGGGTGAGTATTGTCAGATTAATGAACGCAAACTGAAACCGTCTCCACCCACTTCTAATGTCACGTCTGTTTCTACTTGATTTTTAGCAATCTTATTTATTTGACAATGCAGCGACGGTGTTCTTTGCTATATTCATGGGAATATGGGGTGAGTAAATAAGCCTTTGTGTTGGTTTTCGATCTTTCAAAGCAATTTTTTAAAGCAATGCCCTGCTTTAAAGAGCTCAAGCATTTAAAGCATAGGTCTCAAACTGGATTCCTGAAGAGCCGCAGCTCTGCACAGTTTTGCTCCAATAATAATCAAACACAGCTGATGCAACTAATCAAGGTGTTCAAGTCTACTAGACACTATTAAGCAGGTGTGAGTTGGAGCTGGCTGGAGCTAAACTATGCAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38139
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Nonsense 420 915 11 20
Genomic Location (Zv9):
Chromosome 25 (position 36285647)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34719387
GRCz11 25 35224345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGCAGCTCCAGCTCAGACCCGAATACGAGTCCAAGTGCACCAATCGG[C/T]GACTCAACCGCGTCACACAGGTAAACACATTCATTTTGTGAAGTTTTATC
Long Flanking Sequence:
TGGGGTGAGTAAATAAGCCTTTGTGTTGGTTTTCGATCTTTCAAAGCAATTTTTTAAAGCAATGCCCTGCTTTAAAGAGCTCAAGCATTTAAAGCATAGGTCTCAAACTGGATTCCTGAAGAGCCGCAGCTCTGCACAGTTTTGCTCCAATAATAATCAAACACAGCTGATGCAACTAATCAAGGTGTTCAAGTCTACTAGACACTATTAAGCAGGTGTGAGTTGGAGCTGGCTGGAGCTAAACTATGCAGAGCTGCGGCCATCCGGGAATTGAGTTTGAGACCATTGTTTCACTGTAAAACTACAGTGCGGTTGAATGTTGTTGTAAATGTGCCTTCAAGAGCTCTAGTTTTGTCCCTCTGCTGACAGTCACTTTATTCCTGGAGTTCTGGAAGCGGCGTCAGGCCCGGCTGGAGTACGAGTGGGATCTGGTGGACTTTGAGGAAGAGCAACAGCAGCTCCAGCTCAGACCCGAATACGAGTCCAAGTGCACCAATCGG[C/T]GACTCAACCGCGTCACACAGGTAAACACATTCATTTTGTGAAGTTTTATCAAAAATAACTTGCTGATAACAATGCTCAATTTGATCATACAGAGCAGGCTTCGTCTTTTCTGGTCTTGGAAATACAGTTGAAGTTAAAATATTCGCCCTCTTGTGATTTTCTTTCTTTAAATATTTCCCAAATTATGTTAAACAGATTGAGGAAATTTTCACAGTATATCTGATAATATTTATTCCTCTAGAGAAAATCTAATTTGTTTTATTTCGACTGGAGTAAAAACTGTTTAATTATTGAATTTAATTTATTAATTAAAAAAATAAATAAACCTAATATCAATATTACTAGCTCCTTTAAGCAATATATTTTTTTCGATTGTCTGATTACCTTAACTTGCCTAATTAAGTCACTCTTAGCTAAATACTACTATCAGGGCTTAAAATTGCAACTGTTTTGGTCGCATATGCGCCAGAAAGGGTATCTATGCAACCTCAAAATATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Essential Splice Site 451 915 12 20
Genomic Location (Zv9):
Chromosome 25 (position 36290333)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34724073
GRCz11 25 35229031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAAGTGTGCTCGTTCAATACTGTCTGGGGCCACCGTCCTCTTCTGGG[T/C]GAGCATCAACACTGTCTAGTAGACCACTCTTACACTTTTCATTCTCTTTA
Long Flanking Sequence:
TTTCAATTTAACACAAAATGTGCATAATATGACGGTCACTTTAGGTGTTTTCAGCACAAACAATAAGAGAGTTACTACTCAAGATCAGTTTATCATCAATAATTGAAAAAGGAGATGATCTGTTTGGCTTTGCTGGTGTTATGTAGGAACAGGAGTGGGTTCTAGACCAGACTCCAGCCGATAAAGCAGGCAGGTTTGTCCTGTGCTGGACCACTGTTCTCTTATGGGTAAGACAGGAGCAGCACACACAGAGAGCCGTTTGCTGTGTGTGTGTGACGGTGTGTTTAGCGTTAGTGATCTGCTCGCAGTGTGATCTGTAGTCTGTAGAACCAATCACTGTAGAGGAAACAGGACCTGATAGAGAGCAGTACAGGTGTGTGGTGGCGGTTGCTCATGTTCCCTGCTTTGCTTGCTTGCTGTGTAGGAGATGGAGCCTTATTTACCTCTAACAAGCAAGTGTGCTCGTTCAATACTGTCTGGGGCCACCGTCCTCTTCTGGG[T/C]GAGCATCAACACTGTCTAGTAGACCACTCTTACACTTTTCATTCTCTTTATGTGTAAAGTAAAGCACACATGTCATGAATTGCTGTACATTTAATGGTTTTAAGCTAATGTCAGTCACAAAATAATACAGCGGGGTTCAAAAAGTCTAGAAAATGGACAAATCCCTGAAGTTCTAAGATAAATATAACTTATTAAGGATATGCACTTTTCCTCCGGTAACCATATTTTCAAATTCATTGAATGCTATGTGGAATTATTAATGCTATTACATTATTATGGGTCGTTCTCAGATCATGCTGGATTACTTCAGGTTTTGTTCAGCTTAAGTCTTGTTGTCATTCAGGCTAAAAAACACCACATAATACATTAAGCTTAATAGGTTAATTTAATTACTGTGTAGTTAAAAACACCTAATCTAATCACCTATACAAGGTTATGGTTATGGGTTAATGGTTAGTTTAAGCATATGAGTAAAGTTAGAGTTATGGGTTAAAGCTAGG
Associated Phenotype:
Not determined