Busch Lab

ZMP

tnip1

Ensembl ID:
ENSDARG00000015653
ZFIN ID:
ZDB-GENE-070112-1502
Description:
TNFAIP3-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001073421]
Human Orthologue:
TNIP1
Human Description:
TNFAIP3 interacting protein 1 [Source:HGNC Symbol;Acc:16903]
Mouse Orthologue:
Tnip1
Mouse Description:
TNFAIP3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1926194]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15404 Essential Splice Site Available for shipment Available now
sa22553 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28370
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020961 Essential Splice Site 150 652 5 17
ENSDART00000115072 Essential Splice Site 150 653 6 18
Genomic Location (Zv9):
Chromosome 14 (position 51651182)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50403950
GRCz11 14 49391707
KASP Assay ID:
2260-7947.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAAAATTCACAGCATGGTGAATAACTCTGACTTCAACTGTATAATGC[A/G]GGCTGGAGTGCTTCACCTGCCACAGGAGAATTTGGAGCTGGCGAGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15404
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020961 Essential Splice Site 388 652 10 17
ENSDART00000115072 Essential Splice Site 388 653 11 18
Genomic Location (Zv9):
Chromosome 14 (position 51664820)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50417588
GRCz11 14 49405345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACGACAAAAAACTCCTCCTTGCCAAGTCTAAGATCGACAATGTGCAGG[T/C]ACTGATCTCCAGACAGAAACCCATAATCAGTGCTTTTAGGTAGAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22553
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020961 Nonsense 544 652 15 17
ENSDART00000115072 Nonsense 545 653 16 18
Genomic Location (Zv9):
Chromosome 14 (position 51679642)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50432410
GRCz11 14 49420167
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGACAGCGGGAGCTTATGGAGATTTTTGTTTTGGGGTGTTTTGGAGGGG[C/T]AACAGGAAAGGAGGACGTCTGACCCTACGTCTAATGCCCCCAATGGCCCG
Associated Phenotype:
Not determined