Busch Lab

ZMP

sip1

Ensembl ID:
ENSDARG00000015638
ZFIN ID:
ZDB-GENE-030131-3756
Description:
survival of motor neuron protein-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001017608]
Human Orthologue:
SIP1
Human Description:
survival of motor neuron protein interacting protein 1 [Source:HGNC Symbol;Acc:10884]
Mouse Orthologue:
Sip1
Mouse Description:
survival of motor neuron protein interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1913853]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42885 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13139 Essential Splice Site Available for shipment Available now
sa42886 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42885
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013440 Essential Splice Site 185 253 7 10
ENSDART00000013440 Essential Splice Site 185 253 7 10
Genomic Location (Zv9):
Chromosome 17 (position 12957609)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 13083773
GRCz11 17 13094197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGTATTTGATTAATTGGTTTGAAGAGAGGGACTTTGTTCCACAATTGG[T/A]AAGTGAAAAGTGTATTTCTGAGATGTATTTAATGATATGGGCACTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13139
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013440 Essential Splice Site 185 253 7 10
ENSDART00000013440 Essential Splice Site 185 253 7 10
Genomic Location (Zv9):
Chromosome 17 (position 12957609)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 13083773
GRCz11 17 13094197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGTATTTRATTAATTGGTTTGAAGAGAGGGMCTTTGTTCCACAATTGG[T/C]AAGTGAAAAGTGTATTTCTGAGATGTATTTAATGATATGGKCACTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42886
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013440 Essential Splice Site 242 253 9 10
Genomic Location (Zv9):
Chromosome 17 (position 12960423)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 13086587
GRCz11 17 13097011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGATGATCGTTTGTCAGCTCTTAACTTGATGATCTGTATTGTTGCCAG[G/A]TAACTGACACGGCGCTGTTTTGGCCAGATTTAGTGTTTCCTGAAATATGT
Associated Phenotype:
Not determined