Busch Lab

ZMP

cyp3c1

Ensembl ID:
ENSDARG00000015575
ZFIN ID:
ZDB-GENE-030131-3060
Description:
cytochrome P450, family 3, subfamily c, polypeptide 1 [Source:RefSeq peptide;Acc:NP_997838]
Human Orthologues:
CYP3A4, CYP3A43, CYP3A5, CYP3A7
Human Descriptions:
cytochrome P450, family 3, subfamily A, polypeptide 4 [Source:HGNC Symbol;Acc:2637]
cytochrome P450, family 3, subfamily A, polypeptide 43 [Source:HGNC Symbol;Acc:17450]
cytochrome P450, family 3, subfamily A, polypeptide 5 [Source:HGNC Symbol;Acc:2638]
cytochrome P450, family 3, subfamily A, polypeptide 7 [Source:HGNC Symbol;Acc:2640]
Mouse Orthologues:
Cyp3a11, Cyp3a13, Cyp3a16, Cyp3a25, Cyp3a41a, Cyp3a41b, Cyp3a44, Cyp3a57, Cyp3a59
Mouse Descriptions:
cytochrome P450, family 3, subfamily a, polypeptide 11 Gene [Source:MGI Symbol;Acc:MGI:88609]
cytochrome P450, family 3, subfamily a, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:88610]
cytochrome P450, family 3, subfamily a, polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:106099]
cytochrome P450, family 3, subfamily a, polypeptide 25 Gene [Source:MGI Symbol;Acc:MGI:1930638]
cytochrome P450, family 3, subfamily a, polypeptide 41A Gene [Source:MGI Symbol;Acc:MGI:1858451]
cytochrome P450, family 3, subfamily a, polypeptide 41B Gene [Source:MGI Symbol;Acc:MGI:3714859]
cytochrome P450, family 3, subfamily a, polypeptide 44 Gene [Source:MGI Symbol;Acc:MGI:2449818]
cytochrome P450, family 3, subfamily a, polypeptide 57 Pseudogene [Source:MGI Symbol;Acc:MGI:3646373
cytochrome P450, subfamily 3A, polypeptide 59 Gene [Source:MGI Symbol;Acc:MGI:3769707]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33276 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2102 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa33276
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018676 Essential Splice Site 105 505 5 14
ENSDART00000128450 Essential Splice Site 105 130 4 5
ENSDART00000136174 None None 91 None 3
Genomic Location (Zv9):
Chromosome 3 (position 40970163)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40833523
GRCz11 3 40975381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAACGATTTTGGTGAAAGACTGTTATTCTACCTTCACTAACAGACGG[G/T]TGAGGACATCAGTTTTACTAGAACGGACATAACAACATAAAGAGAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2102
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018676 Essential Splice Site 174 505 8 14
ENSDART00000128450 None None 130 None 5
ENSDART00000136174 None None 91 None 3
Genomic Location (Zv9):
Chromosome 3 (position 40969464)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40832824
GRCz11 3 40974682
KASP Assay ID:
554-2834.1 (used for ordering genotyping assays)
KASP Sequence:
TAAATGATCACTATATTATATATTTAACAAGAAGCCCCTATTTGTGTTTC[A/C]GTGTTGTGGCTCCATACAGTTTAGATGTTGTCGCCAGCTCCTCCTTCAGY
Associated Phenotype:
Not determined