Busch Lab

ZMP

zic1

Ensembl ID:
ENSDARG00000015567
ZFIN ID:
ZDB-GENE-000208-4
Description:
zinc finger protein ZIC 1 [Source:RefSeq peptide;Acc:NP_571008]
Human Orthologue:
ZIC1
Human Description:
Zic family member 1 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12872]
Mouse Orthologue:
Zic1
Mouse Description:
zinc finger protein of the cerebellum 1 Gene [Source:MGI Symbol;Acc:MGI:106683]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12532 Nonsense Available for shipment Available now
sa5987 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5071
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016546 None None 360 1 4
ENSDART00000127597 Nonsense 9 442 1 3
Genomic Location (Zv9):
Chromosome 24 (position 5053193)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 4941686
GRCz11 24 4973473
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTCCTCCGCTGCAGACTGAAGATGCTCTTGGAMGCAGGACCACAGTA[T/A]CCCACCATTGGAGTGACTACTTTCGGCTCCACCAGACATCACTCAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016546 None None 360 1 4
ENSDART00000127597 Nonsense 35 442 1 3
Genomic Location (Zv9):
Chromosome 24 (position 5053116)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 4941609
GRCz11 24 4973396
KASP Assay ID:
2261-8373.1 (used for ordering genotyping assays)
KASP Sequence:
CTCCACCAGACATCACTCAACAGGCGAAGTTACAGACAGAGAAGTGGCTT[T/A]GGGTATCAAWCCGTTCGCCGACGGTATGGGCGCTTTTAAAATCAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5987
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016546 Essential Splice Site 279 360 1 4
ENSDART00000127597 Essential Splice Site 322 442 1 3
Genomic Location (Zv9):
Chromosome 24 (position 5052252)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 4940745
GRCz11 24 4972532
KASP Assay ID:
554-3870.1 (used for ordering genotyping assays)
KASP Sequence:
AGWATTTGCCCGATCGGAAAATCTGAAAATCCACAAAAGAACACACACAG[G/A]TAAGAAAATCKTTATTTTCATCTCTAAATACACGTTCATTCCTAGTTTTT
Associated Phenotype:
Not determined