Busch Lab

ZMP

zgc:100829

Ensembl ID:
ENSDARG00000015557
ZFIN ID:
ZDB-GENE-040801-54
Description:
hypothetical protein LOC445149 [Source:RefSeq peptide;Acc:NP_001003543]
Human Orthologue:
SH2D2A
Human Description:
SH2 domain containing 2A [Source:HGNC Symbol;Acc:10821]
Mouse Orthologue:
Sh2d2a
Mouse Description:
SH2 domain protein 2A Gene [Source:MGI Symbol;Acc:MGI:1351596]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23961 Nonsense Available for shipment Available now
sa23962 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29617
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014058 Nonsense 10 307 2 8
ENSDART00000137874 Nonsense 10 210 2 5
ENSDART00000145178 Nonsense 10 173 1 3

The following transcripts of ENSDARG00000015557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28144271)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28713182
GRCz11 21 28749877
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAACTCCACACACTTGGCCATGCTGCAGCAGATCCTGAAGGACATGTA[C/A]ATCGACCCTGATGTGCTGGAAGCTCTGAATGACGAGCAGAAGAAGATGCT
Long Flanking Sequence:
GCTGTCGCGTCCCATGATTAATAAAGGGACTAAGCCAAAGCAAAATGAATAAATGAAGGAATAAATGCACCAAACATATTTGGTTACGTCTTTAATGAATTAATAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGTCGAACGAACGAACGAACGAACGAACATTGACACACACACACACACACACACACATACACTGCGCAGGAAAACTAAGAACAAATCAACTCTTAAAACTCTGATGCCATTATTCCTCCGGATGCTGTAATGTGTGTTTTCTCTTTGACAGTGTGTCCTCTGTATGGCTGCCGGTCAGTGATGCGAGCACGTGTGTGGTGAACAGATCCGTCTTCATCCTCATCTTCATCCTCCATCTGAAGTTTTCGGGATACATTAAGGAACTCCACACACTTGGCCATGCTGCAGCAGATCCTGAAGGACATGTA[C/A]ATCGACCCTGATGTGCTGGAAGCTCTGAATGACGAGCAGAAGAAGATGCTCTTCCTGAAGATGCGCGAGGAGCAGGTGCGCCGCTGGAAGGAGCGTGAGGAGAAGCTGGAGAGGGAACCGCTCAAACCCAAAGCAAAGACAGGTGGGAGATGGATTAATACTGCACTGATTTCATTTGTAACACACAGAGATGTGATAAGCGGTGCAATTTATTGAAGGAATTTAAATATTATAGTTATTTTTCAAACATTATAAATGAATTTGTGTTTTAATATAAAGAATTAAACAGTGCTGAAATTGTTTATTTATAAATCCATTCCTGCACAAAAGTATTTTATAAATTTAAGAAGCTTTTAATAATAATAATAATAATAATAATAACAACAAAAATATTATTATTATTATTATTATTATCAGTTTAAGAATTAGTCATCTTTGGAAGGTCAAATCCTGATCACAATCAGGAATATAAGATCATAGTTGGAATATAATAAAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23961
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014058 Nonsense 261 307 8 8
ENSDART00000137874 None None 210 None 5
ENSDART00000145178 None None 173 None 3

The following transcripts of ENSDARG00000015557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28187338)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28756249
GRCz11 21 28792944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTCTCAATGGATTTGGGGTCCGAGGTTGTTGAAGAGAGCTGTTTGGGA[C/T]GAGGAAGGGTTGCTCAGCTCATGAAAACCTTCAGCGTGTGCGGCGAGTCT
Long Flanking Sequence:
GGTGTCTGAGCAGCGTCTGTCTGCTCTCCGCCGCCATCCCTGCGGCCCTCCTCTCCTCATCTTCCATCCCTCCATCTCTCAATTACACACACATACACACAGTGTAACCACACACACTCTTACGCACCCATAACCGTGTACACACACACTCACCAACTACACCCAGCTGCGTCCCTGCTCTACTTCCTGCGCCGACGACCTCCGGTCTGGCAGTCAGCAGCCCAGGAAAAAAACACACTGAATGAGAGCAGAGAAAGAAAAAAAAAGGATAGAACAGAGTGCGAAGTGAGGGAAAAGGGCAGAAGAAAGGTGTGGTGTTGAAGAGGGCAAGTGTGAGAGTGTTTTGAAGTTGTCATCTATAAAAACACACTTTGAAGGTCATAATCTCTTGTCTCTCCATTCTCTTCGGGTTTGCAGGTGATATCCGAGTGGTTGCCGCCTCTAAACGGGTGTTCTCAATGGATTTGGGGTCCGAGGTTGTTGAAGAGAGCTGTTTGGGA[C/T]GAGGAAGGGTTGCTCAGCTCATGAAAACCTTCAGCGTGTGCGGCGAGTCTCCACCCTGTCAGTCTCCGCCCCGTGCCAATAAACCTCCAATCCCGGAAAAACCGAACCACTTGAGGCTCCGCCCCTCACCCTCTCTCAGGTAATCCACATGGGACAAACCCCTGAGCAACAATCAAGACAACTAAAACAGGGGTCTTTATCAGCGGCTACAATGAAGGGTGTGGGTGCTCGGCCTTTCTCAGGAACTTGAATATTTAGTTGCCAAAGTTATGCTTTTTATTTTTGCAATATTGATGTTTTTCTTCATTATTTGTATTTTTATATGGTATGAGAGGTTTGCAAAACTTTTCAGCAGGAATGACACACTCGATATTTTGTTACATCGCTCCAATTGTTGACCTGTCTAGCTCATAATGCACTCAGACTCATACTTACAAGTGTGTTTCTGTTTTAAAGGGTCACATGATATCTTACTCAGATTGAGAACTCGTAATGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23962
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014058 Nonsense 288 307 8 8
ENSDART00000137874 None None 210 None 5
ENSDART00000145178 None None 173 None 3

The following transcripts of ENSDARG00000015557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28187419)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28756330
GRCz11 21 28793025
KASP Assay ID:
2261-5756.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCGTGTGCGGCGAGTCTCCACCCTGTCAGTCTCCGCCCCGTGCCAAT[A/T]AACCTCCAATCCCGGAAAAACCGAACCACTTGAGGCTCCGCCCCTCACCC
Long Flanking Sequence:
ATTACACACACATACACACAGTGTAACCACACACACTCTTACGCACCCATAACCGTGTACACACACACTCACCAACTACACCCAGCTGCGTCCCTGCTCTACTTCCTGCGCCGACGACCTCCGGTCTGGCAGTCAGCAGCCCAGGAAAAAAACACACTGAATGAGAGCAGAGAAAGAAAAAAAAAGGATAGAACAGAGTGCGAAGTGAGGGAAAAGGGCAGAAGAAAGGTGTGGTGTTGAAGAGGGCAAGTGTGAGAGTGTTTTGAAGTTGTCATCTATAAAAACACACTTTGAAGGTCATAATCTCTTGTCTCTCCATTCTCTTCGGGTTTGCAGGTGATATCCGAGTGGTTGCCGCCTCTAAACGGGTGTTCTCAATGGATTTGGGGTCCGAGGTTGTTGAAGAGAGCTGTTTGGGACGAGGAAGGGTTGCTCAGCTCATGAAAACCTTCAGCGTGTGCGGCGAGTCTCCACCCTGTCAGTCTCCGCCCCGTGCCAAT[A/T]AACCTCCAATCCCGGAAAAACCGAACCACTTGAGGCTCCGCCCCTCACCCTCTCTCAGGTAATCCACATGGGACAAACCCCTGAGCAACAATCAAGACAACTAAAACAGGGGTCTTTATCAGCGGCTACAATGAAGGGTGTGGGTGCTCGGCCTTTCTCAGGAACTTGAATATTTAGTTGCCAAAGTTATGCTTTTTATTTTTGCAATATTGATGTTTTTCTTCATTATTTGTATTTTTATATGGTATGAGAGGTTTGCAAAACTTTTCAGCAGGAATGACACACTCGATATTTTGTTACATCGCTCCAATTGTTGACCTGTCTAGCTCATAATGCACTCAGACTCATACTTACAAGTGTGTTTCTGTTTTAAAGGGTCACATGATATCTTACTCAGATTGAGAACTCGTAATGAGACCAAATCATGATCGTAATCCAAAGTTAATCATCCCATTGGTTTGTTATGTATTAAATATGTTGCTTCCTTGAAGTATTGAAGG
Associated Phenotype:
Not determined