Busch Lab

ZMP

klf3

Ensembl ID:
ENSDARG00000015495
ZFIN ID:
ZDB-GENE-011116-1
Description:
Krueppel-like factor 3 [Source:RefSeq peptide;Acc:NP_571934]
Human Orthologue:
KLF12
Human Description:
Kruppel-like factor 12 [Source:HGNC Symbol;Acc:6346]
Mouse Orthologue:
Klf12
Mouse Description:
Kruppel-like factor 12 Gene [Source:MGI Symbol;Acc:MGI:1333796]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa19464 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014916 Essential Splice Site 176 328 5 7

The following transcripts of ENSDARG00000015495 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 17343155)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17908323
GRCz11 1 18601260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATATATCCTTACGCTTCTGCATGTTTGATACATTTGTCTCTTGTCTTC[A/T]GTCTCTGTAATAAAGTCAGAGAATACTTCGGACCACCATGAGCTTCTCAA
Associated Phenotype:
Not determined