Busch Lab

ZMP

iqch

Ensembl ID:
ENSDARG00000015476
ZFIN ID:
ZDB-GENE-050419-242
Description:
IQ motif-containing protein H [Source:UniProtKB/Swiss-Prot;Acc:Q1LXZ7]
Human Orthologue:
IQCH
Human Description:
IQ motif containing H [Source:HGNC Symbol;Acc:25721]
Mouse Orthologue:
Iqch
Mouse Description:
IQ motif containing H Gene [Source:MGI Symbol;Acc:MGI:1925500]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa36633 Nonsense Mutation detected in F1 DNA Not yet available
sa29020 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079691 Nonsense 97 1079 4 21
ENSDART00000135049 Nonsense 97 1059 4 21
ENSDART00000147470 None None 180 None 3
Genomic Location (Zv9):
Chromosome 18 (position 19602831)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19833054
GRCz11 18 19822120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAATTGAGATCCAACATATCTAGCCTTTTTTGTAGGCAACCACCATA[C/A]GAAGCATTACCAATTGCACATCCACATAGAAGCCCGATTCCAGGTCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29020
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079691 Essential Splice Site 578 1079 13 21
ENSDART00000135049 Essential Splice Site 578 1059 13 21
ENSDART00000147470 None None 180 None 3
Genomic Location (Zv9):
Chromosome 18 (position 19622842)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19853065
GRCz11 18 19842131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTTAGTGTCCCTTTATCTCCTAATGGTGCATTATATTTCTCTTTC[A/T]GACCCGAAACTTATGTCTAGCTTCGCTCCTGAAATACAGTCCACGAACTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29021
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079691 Essential Splice Site 928 1079 18 21
ENSDART00000135049 Essential Splice Site 908 1059 18 21
ENSDART00000147470 None None 180 None 3
Genomic Location (Zv9):
Chromosome 18 (position 19654925)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19885148
GRCz11 18 19874214
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAATTCTGAAATAACACCCTTTTGACTCTGTGTTTATATGCTCTCCTC[A/T]GGAAACCTCAGTGACCAGTCGATTTGCAGTGATGTGCACCCGGCTTCTTC
Associated Phenotype:
Not determined