Busch Lab

ZMP

gpc4

Ensembl ID:
ENSDARG00000015472
ZFIN ID:
ZDB-GENE-011119-1
Description:
glypican-4 [Source:RefSeq peptide;Acc:NP_571935]
Human Orthologue:
GPC4
Human Description:
glypican 4 [Source:HGNC Symbol;Acc:4452]
Mouse Orthologue:
Gpc4
Mouse Description:
glypican 4 Gene [Source:MGI Symbol;Acc:MGI:104902]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22505 Nonsense Available for shipment Available now
sa9771 Nonsense Available for shipment Available now
sa11933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22505
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 18 557 1 9
Genomic Location (Zv9):
Chromosome 14 (position 32020886)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30810693
GRCz11 14 31151007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGATGATCGTTGTGTTTACAGTATGTATGTCTGTGGTGGTTTTGGCGT[C/A]GGCTCAGGCTGATCAGAAGTCAAAGAACTGCAATGAAGTCAGAACTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9771
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 28 557 1 9
Genomic Location (Zv9):
Chromosome 14 (position 32020855)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30810662
GRCz11 14 31150976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTGGTGGTTTTGGCGTCGGCTCAGGCTGATCAGAAGTCAAAGAACTG[C/A]AATGAAGTCAGAACTGCCTACAGTTCCAAAGGTTTCAACGTCAACGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11933
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026569 Nonsense 335 557 5 9
Genomic Location (Zv9):
Chromosome 14 (position 31965834)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30755641
GRCz11 14 31095955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTTCAGATGCTATCATGAACATGCAGGAGAACAGCATGCAGGTCTCA[C/T]AGAAGGTGGGCTTTTAGTATTTTTYCCATGATGACATGGGAAATCATTTA
Associated Phenotype:
Not determined