Busch Lab

ZMP

chd1l

Ensembl ID:
ENSDARG00000015471
ZFIN ID:
ZDB-GENE-040426-892
Description:
Chromodomain-helicase-DNA-binding protein 1-like [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU90]
Human Orthologue:
CHD1L
Human Description:
chromodomain helicase DNA binding protein 1-like [Source:HGNC Symbol;Acc:1916]
Mouse Orthologue:
Chd1l
Mouse Description:
chromodomain helicase DNA binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:1915308]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa14029 Nonsense Available for shipment Available now
sa18631 Nonsense Available for shipment Available now
sa9462 Nonsense Available for shipment Available now
sa8828 Nonsense Available for shipment Available now
sa26779 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 6 1026 1 25
Genomic Location (Zv9):
Chromosome 6 (position 36792789)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36866379
GRCz11 6 36844273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCAGATGATTTAACATAAACGTAAACAACAAGGATGTCCACATTTCTT[C/T]GAGCAGTCAGAARCAACATACCAGAAAAGGACAAATCTGAACTAACGGAG
Long Flanking Sequence:
AGATTACATTTTACTGAATGTGTTTTAAATGTGTTGTAAAACAGATTTGTAAATGTTATGAAATGTCTTAAAATTGATATTTATTAAAGTAGATATTGCAGTTATATACTAAAAAGCTGACCTTCTATTTTTTTCTGTATCTTTGTCTGATACTATTTGTAAATGAAGTCTAGCTCAATTTTTTTTTCTGTGTCAGAATGTTGAATATAATTCAAAGGATAATCCGAGATTTGAGAATTTAAGATCTTTACACACGTATTCTTTATAAAATATACATATTTTAAATATATATGTACTTTTTTAAGAATGGCGCCTTTAAAGAGCGCGTGCTTGCGTTGCCAACTTGTCATTGGACAGCGTCAGTTTTGCTACCCGCCCATTCACTATTGCAGGAAGTAGAAAAACAAGTCACGTCAAACTGGCGCGCACAAGCTATTAAAGAGAAAAGAAATTCAGATGATTTAACATAAACGTAAACAACAAGGATGTCCACATTTCTT[C/T]GAGCAGTCAGAAACAACATACCAGAAAAGGACAAATCTGAACTAACGGAGAATGACCTGAAGAAATGGGGACTTGGAGGTGTGTGGAGCAATTGCGAGCTAACTTACTTGTTTAAGTTAATGTTTAACGCTTAACCCTACGTTAATCGTATTTAGCCCGTTTTGGATCAGGTAAATCATTAGTTTACAAAAAGTTTTGGATATAACGTTACATCAATAACGTACCGATAACTTCTCGTTAATGAATTTGCTTAAAAAAGTTTTACATTCCCAAAGTTTTACCTCATTGCCCATTTGTATTTATAAAAATACGAAGAATCATTTGCGATTTAGATGCATAGATTTACGTTTGTGAACTTCATATAGAAAACTTATGCCATTTTATTTTGATAAATTACATTTATAAGTACATTTAATATGATAATTACCTGGATCAACCCTTTTAATAGAAATTAATACCGTACATTTATTTCTCATGATTAGCTCAAGAACAATCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18631
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 73 1026 3 25
Genomic Location (Zv9):
Chromosome 6 (position 36796347)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36869937
GRCz11 6 36847831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCAGATATGAGATAAGTGAGATGTCATGCTCTGCTGTAGACCATCTYTT[T/A]GCTGGCGTATGCTCGAGGAAGCCTTAAGATGAACGGGCCGTTCCTTGTGC
Long Flanking Sequence:
GATGGTGTTATTACATAACACCATCAAAGCTGTAAAAGGAACTTTATGAAAGGGAAAATAGTCGCATGAAGCTTTCACCGGAAGTTCCTTATTGGCTGAAAAACACTAGCTGTGCATATATTTTCGGGCATGATTGACTTTTCACGTGTCACATTAATTGGAGCAGTGAAATAAGGCTTCGAACACCTGTTACATGATTTAAAATACTCTAAATCTGAAAGTTTTTTTCTTACAAACAACGCTGTTATCCTTTATCTCTTTCCTAATAGCTATTCATCTGAGGCCTTATCAGCTGGATGGAGTGAAGTGGCTGTCACTGTGTATGAAGAACCAGCAGGGCTGCATCCTCGGTGATGAGATGGGTCTGGGCAAGACCTGTCAGGTTAGTAATGGGATGGCTTTATCTTGCTTATATTGCTTGCTTTTAAGCCGAAAGATTTATTCCGAGATGTCAGATATGAGATAAGTGAGATGTCATGCTCTGCTGTAGACCATCTCTT[T/A]GCTGGCGTATGCTCGAGGAAGCCTTAAGATGAACGGGCCGTTCCTTGTGCTTTGTCCCTTGGCTGTTTTGGAGAACTGGAGGCAAGAGTTGGAACGGTAAGAGACATTGGTTGTGATCAGAATTGTGTGGTCAATTTAGATTATGAAGAATGCACGATAAAGTTCTTGGTTCATTACTGTGCTGCTATGAATGCTTACATTTTTAGTAATCGATAACAGTTTACTTCTATGACATTTCTTATTCATTTTAATGACTTTCAGATTCATAAAATGTTTTTTTGTGTTCAGCAGAAAAAAAGTAATTCATAAATGTTTGGCCCCAATTGAGGATATGTAAATGATTCGATTTTAGTTTAACTAACCCTTAAAATAGCTTAAAATGGATATTTATTAAATCAGAGACTGTTAAAAGTTGCAATTTCTGTTTTTCGAAATTTGTTTCAATATTGTGTAATGGTAACATTGTAAATAAAAGACTAGCTTCGGTTTGCTGGGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9462
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 675 1026 18 25
ENSDART00000020505 Nonsense 675 1026 18 25
Genomic Location (Zv9):
Chromosome 6 (position 36814255)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36887843
GRCz11 6 36865737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCCTTTGTCTTTCRTTGRCAGGATGGCATGGTGGGACTCATGTGGSTA[C/A]AGATCACTGTGTTTGCCAYGCGTCGACAGTGAGGGTGAAGATATGGAGCC
Long Flanking Sequence:
GCTTTAAACAACGCAAAAACAACCAATTTTTACTTTTTAGTGAATTATATGTGTCTTAATAGTGTTTATAGCATCGTAGGACATATATATTCAATTCAATTCCCCTTTATCTACAATGTAGATTGTGTCAAAGCAGCCCCACATAGAAGATCATATATGACTGTCAACATCTCAAAAAAATGTGTTTCGTGACCTCTTAAATAAGATTAATACCTGCTGATTATTTTGCTAGTTTTAAGAAAAACTCACTTTATTTTGACAATTTTTTTTGCTTGTCCAGAAAATGCTTCTTTATTTAAGAATTTTTTTTATATAGAAACAAGAAAAAACTAAGTAAGAAAAGCCTTTTTTGCAGTGCGTTCACACAAAGCATAATGGGGCATAAGAATAAGTTGGAAATCGTATATATATTTATTGTGTTTTCCTGTAGGAGTCTGTTTTATATCCTATATGCCTTTGTCTTTCATTGGCAGGATGGCATGGTGGGACTCATGTGGCTA[C/A]AGATCACTGTGTTTGCCACGCGTCGACAGTGAGGGTGAAGATATGGAGCCTGATGAAGATGATCACGTCAGCTTTAGCTCCACCGATTCAGATCACACAGCCATTCGATATGTGCTGGGTGATGTAACTCATCCTCAAGCCGATCGAGAGGATGCCATCATTGTGCATTGTGTTGGTACGGCTCTACTAAATACTGTTTGTCTGTAACAGAGACATCTTGATGACAGAAAACCATTGACAACCACATACTGCTAATTTGGTCTGATTTTTATGGTGTGTGATGCTCTTATTTTATAGATGACTCTGGACACTGGGGCCGGGGAGGATTATTTACTGCACTGGAGCTCAGATCAGACGAGCCGAGGAAGCAGTACGAGTTGGCCGGCGACATGAAAGGTGACAAATTCTTTCATGTTTGCTTGGACAGGTTTAATTCATGCTCTGCCAATGCAAACATTTGACATTGACGTCAGTATCCAGTTCACAGCTCTCTAATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8828
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 675 1026 18 25
ENSDART00000020505 Nonsense 675 1026 18 25
Genomic Location (Zv9):
Chromosome 6 (position 36814255)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36887843
GRCz11 6 36865737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCCTTTGTCTTTCRTTGRCAGGATGGCATGGTGGGACTCATGTGGSTA[C/A]AGATCACTGTGTTTGCCAYGCGTCGACAGTGAGGGTGAAGATATGGAGCC
Long Flanking Sequence:
GCTTTAAACAACGCAAAAACAACCAATTTTTACTTTTTAGTGAATTATATGTGTCTTAATAGTGTTTATAGCATCGTAGGACATATATATTCAATTCAATTCCCCTTTATCTACAATGTAGATTGTGTCAAAGCAGCCCCACATAGAAGATCATATATGACTGTCAACATCTCAAAAAAATGTGTTTCGTGACCTCTTAAATAAGATTAATACCTGCTGATTATTTTGCTAGTTTTAAGAAAAACTCACTTTATTTTGACAATTTTTTTTGCTTGTCCAGAAAATGCTTCTTTATTTAAGAATTTTTTTTATATAGAAACAAGAAAAAACTAAGTAAGAAAAGCCTTTTTTGCAGTGCGTTCACACAAAGCATAATGGGGCATAAGAATAAGTTGGAAATCGTATATATATTTATTGTGTTTTCCTGTAGGAGTCTGTTTTATATCCTATATGCCTTTGTCTTTCATTGGCAGGATGGCATGGTGGGACTCATGTGGCTA[C/A]AGATCACTGTGTTTGCCACGCGTCGACAGTGAGGGTGAAGATATGGAGCCTGATGAAGATGATCACGTCAGCTTTAGCTCCACCGATTCAGATCACACAGCCATTCGATATGTGCTGGGTGATGTAACTCATCCTCAAGCCGATCGAGAGGATGCCATCATTGTGCATTGTGTTGGTACGGCTCTACTAAATACTGTTTGTCTGTAACAGAGACATCTTGATGACAGAAAACCATTGACAACCACATACTGCTAATTTGGTCTGATTTTTATGGTGTGTGATGCTCTTATTTTATAGATGACTCTGGACACTGGGGCCGGGGAGGATTATTTACTGCACTGGAGCTCAGATCAGACGAGCCGAGGAAGCAGTACGAGTTGGCCGGCGACATGAAAGGTGACAAATTCTTTCATGTTTGCTTGGACAGGTTTAATTCATGCTCTGCCAATGCAAACATTTGACATTGACGTCAGTATCCAGTTCACAGCTCTCTAATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26779
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 711 1026 18 25
Genomic Location (Zv9):
Chromosome 6 (position 36814361)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36887949
GRCz11 6 36865843
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGATGATCACGTCAGCTTTAGCTCCACCGATTCAGATCACACAGCCATT[C/T]GATATGTGCTGGGTGATGTAACTCATCCTCAAGCCGATCGAGAGGATGCC
Long Flanking Sequence:
TTATCTACAATGTAGATTGTGTCAAAGCAGCCCCACATAGAAGATCATATATGACTGTCAACATCTCAAAAAAATGTGTTTCGTGACCTCTTAAATAAGATTAATACCTGCTGATTATTTTGCTAGTTTTAAGAAAAACTCACTTTATTTTGACAATTTTTTTTGCTTGTCCAGAAAATGCTTCTTTATTTAAGAATTTTTTTTATATAGAAACAAGAAAAAACTAAGTAAGAAAAGCCTTTTTTGCAGTGCGTTCACACAAAGCATAATGGGGCATAAGAATAAGTTGGAAATCGTATATATATTTATTGTGTTTTCCTGTAGGAGTCTGTTTTATATCCTATATGCCTTTGTCTTTCATTGGCAGGATGGCATGGTGGGACTCATGTGGCTACAGATCACTGTGTTTGCCACGCGTCGACAGTGAGGGTGAAGATATGGAGCCTGATGAAGATGATCACGTCAGCTTTAGCTCCACCGATTCAGATCACACAGCCATT[C/T]GATATGTGCTGGGTGATGTAACTCATCCTCAAGCCGATCGAGAGGATGCCATCATTGTGCATTGTGTTGGTACGGCTCTACTAAATACTGTTTGTCTGTAACAGAGACATCTTGATGACAGAAAACCATTGACAACCACATACTGCTAATTTGGTCTGATTTTTATGGTGTGTGATGCTCTTATTTTATAGATGACTCTGGACACTGGGGCCGGGGAGGATTATTTACTGCACTGGAGCTCAGATCAGACGAGCCGAGGAAGCAGTACGAGTTGGCCGGCGACATGAAAGGTGACAAATTCTTTCATGTTTGCTTGGACAGGTTTAATTCATGCTCTGCCAATGCAAACATTTGACATTGACGTCAGTATCCAGTTCACAGCTCTCTAATTCTTTCTCCTAAAAAACTATTTTAAATAAATATAGTCAAACCTATAAAATAAAATGTCAAACGTATGATTTTTTTTTTGTAAAAAAAAAAAAGCAATCGTACAATTTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2317
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020505 Nonsense 870 1026 23 25
Genomic Location (Zv9):
Chromosome 6 (position 36821548)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36895126
GRCz11 6 36873020
KASP Assay ID:
554-3251.1 (used for ordering genotyping assays)
KASP Sequence:
AATAGTTGTATTATTTTATCCTTGACTCATTATTCAGTTACTACTACAGA[C/T]GAGGATCTTCACACRCTACAGTGTCTTCCACTGCTWGCACCACCACTCCA
Long Flanking Sequence:
TAACAAGTATAGAGGATATATTTAAGTCCATATATATCAAAACGAATCCCACTGAAAGCAAAATGCGAAGCACTGGTTAAATATTCTAATGATGTGATACATATTCAAGTATAACCCTGTGCCATAATTTCTTTGTAGTGTTTTTTTTTTTTTTGGTGGCAAAGGTTTTTGGTCACGTTTATTCAAACAGCACTTTATGCAGTGTATTCTTTAAAGGAACTATGTAGGATTATTATATAGGAAGTATGTTTTAATCAAAATTACAACTTAATTTTGTTAACTTATGTAATAAAAACAGATCATAGTTCCTTCCAAGATTTTTACCAGCCAGAGCAACTTTTGGAAAGTTTGCTTTGGAAACCAGTTTACAGCCAAATTCACTTTGGCTTGATTTCATCTGAAACTATTCTCCAGTTTCAAATAACATGAAATGAGGCATTTATAAACCGAAATAGTTGTATTATTTTATCCTTGACTCATTATTCAGTTACTACTACAGA[C/T]GAGGATCTTCACACACTACAGTGTCTTCCACTGCTAGCACCACCACTCCATCAAGCTCAAAGCCTGCAGCATCCTCACCATCTGAGTCCCCACACTCCTCCAGTCCTCCGGCTAACAGAGAAGGTCTAACAAAGTCAGCAGAACTCTCCACTACATCACATGAAGGTCCGGGGGCTCCAGGGTTGGCTGACTTCATGAGAGGCGTTCATGTCTACTTTTATAACATGGCTGCTACAGAGAAGAAGAAACTAACCCGCTACCTTATCACATATCCTTTACAATTCAAAAACAATCATCGAAACAATGCTGCCATGGAAAGGCAATAGCTTTTGACATCATTTGGAGAAGTATCTTGAGTCAGTGGAGTAACAATAACTTCCTAAAGCATGGGAGAAACTTCATTTGACTTAATTTTGATTGATTTTGAAAGAGTTATAGTAATCTGGGTGTTTTCGTGGGTATCGCTGTCGCCTCACAGCAAGCAAGTCGCTGGTTCGCGT
Associated Phenotype:
Not determined