Busch Lab

ZMP

st3gal3

Ensembl ID:
ENSDARG00000015374
ZFIN ID:
ZDB-GENE-040426-1322
Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 3 [Source:RefSeq peptide;Acc:NP_956649]
Human Orthologue:
ST3GAL3
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 3 [Source:HGNC Symbol;Acc:10866]
Mouse Orthologue:
St3gal3
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1316659]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa16184 Essential Splice Site Available for shipment Available now
sa16072 Essential Splice Site Available for shipment Available now
sa26657 Nonsense Mutation detected in F1 DNA Not yet available
sa33791 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33792 Nonsense Mutation detected in F1 DNA Not yet available
sa20610 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16184
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Essential Splice Site 37 372 None 12
ENSDART00000130879 Essential Splice Site 40 375 None 12
ENSDART00000132848 Essential Splice Site 40 70 None 4
ENSDART00000023072 Essential Splice Site 37 372 None 12
ENSDART00000130879 Essential Splice Site 40 375 None 12
ENSDART00000132848 Essential Splice Site 40 70 None 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3150881)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3183649
GRCz11 6 3343944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTATTCCTCCGGTAGAKTGCAACTAAAGAACTCAGTCCAGAAATCTCG[T/A]GAGTATATCATTTACTCMTTCTTGTCATGTTTTTCCAACACGTGTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16072
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Essential Splice Site 37 372 None 12
ENSDART00000130879 Essential Splice Site 40 375 None 12
ENSDART00000132848 Essential Splice Site 40 70 None 4
ENSDART00000023072 Essential Splice Site 37 372 None 12
ENSDART00000130879 Essential Splice Site 40 375 None 12
ENSDART00000132848 Essential Splice Site 40 70 None 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3150881)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3183649
GRCz11 6 3343944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTATTCCTCCGGTAGAKTGCAACTAAAGAACTCAGTCCAGAAATCTCG[T/A]GAGTATATCATTTACTCMTTCTTGTCATGTTTTTCCAACACGTGTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26657
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Nonsense 40 372 3 12
ENSDART00000130879 Nonsense 43 375 3 12
ENSDART00000132848 Nonsense 43 70 3 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3157883)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3190651
GRCz11 6 3350946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATATGCTTCAGTGTGTTGAACTTACACTCTTGTGTTTCAGAGGCTGATT[T/A]GGATAGTTTACTCTCCGTGGGACGTGTAGTAGCTTCAGGTAGAGGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33791
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Essential Splice Site 129 372 6 12
ENSDART00000130879 Essential Splice Site 132 375 6 12
ENSDART00000132848 None None 70 None 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3174124)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3206892
GRCz11 6 3367187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATCAAAGATCAGCAGTTACCCACCTCCTTTTGGAGTAAGAACACAAG[G/A]TATTTATTTTAATCGCCTGTTTACTTGCTCTACCATAGTCAATCGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33792
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Nonsense 272 372 10 12
ENSDART00000130879 Nonsense 275 375 10 12
ENSDART00000132848 None None 70 None 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3202541)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3235309
GRCz11 6 3395604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACGTGTCGTTCCTAGAGCTCCACAAGACATGCGGATCCTGAACCCCTA[T/A]TTCATACAGGAAGCCTCGTTCAGATTAATCGGCCTTCCACACAACAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20610
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023072 Nonsense 321 372 11 12
ENSDART00000130879 Nonsense 324 375 11 12
ENSDART00000132848 None None 70 None 4

The following transcripts of ENSDARG00000015374 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 3205867)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3238635
GRCz11 6 3398930
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATGGCCCTCCATAACTGTGATGAAGTAGCGGTAGCCGGATTCGGATA[T/A]GACATGAACACCCCTCATGCACCTCTGCACTATTATGAGAAGCTGAGGAT
Associated Phenotype:
Not determined