Busch Lab

ZMP

FCHO1

Ensembl ID:
ENSDARG00000015356
Description:
FCH domain only 1 [Source:HGNC Symbol;Acc:29002]
Human Orthologue:
FCHO1
Human Description:
FCH domain only 1 [Source:HGNC Symbol;Acc:29002]
Mouse Orthologue:
Fcho1
Mouse Description:
FCH domain only 1 Gene [Source:MGI Symbol;Acc:MGI:1921265]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa2424 Essential Splice Site Available for shipment Available now
sa21259 Nonsense Available for shipment Available now
sa6096 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8877 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa2424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 65 895 3 32
Genomic Location (Zv9):
Chromosome 8 (position 20579254)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20009151
GRCz11 8 20041236
KASP Assay ID:
554-2725.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTCCATGAGCAAACTGGCCAAGATGGCCAGCAATGGAAGCCCTCTGGG[G/A]TGAGTGACATCATTACTGTTATCATGATCCCTGTTCCRTCCCATTCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27174
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 264 895 9 32
Genomic Location (Zv9):
Chromosome 8 (position 20586336)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20016233
GRCz11 8 20048318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGCTGAGCTTCAGACTTTGTTTATTAATTGTGTTTCTGTGTGTTTTGA[A/G]AAAGGTCCAGTGGGATTTGAGGAATATCTGTCCTCGCTGGCATCTGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Nonsense 486 895 18 32
Genomic Location (Zv9):
Chromosome 8 (position 20597174)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20027071
GRCz11 8 20059156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCCTCTCTTGAGAATGTGGAGGATTCTGGACTGGATTCACCTTCTCAT[C/T]AGCCTCTTGGAGTTTCCCCTGATCCCACAGGATGGGCAGCCTGGCCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 576 895 22 32
Genomic Location (Zv9):
Chromosome 8 (position 20601107)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20031004
GRCz11 8 20063089
KASP Assay ID:
554-3655.1 (used for ordering genotyping assays)
KASP Sequence:
ACTATAAAGTCAGAATTCTGAGTTATATGTGCTCACTCCATTTACAGTCA[G/T]TCGCCATAACAAGAAACTCAGAATATAACTCTGAATTCTGACTTTATAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27175
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Essential Splice Site 581 895 23 32
Genomic Location (Zv9):
Chromosome 8 (position 20601243)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20031140
GRCz11 8 20063225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATAACCCAGAATTCTCACTTTTTAACCTGGAATTCTGACTTTTTAACC[T/C]GGAATTCTGACTTTGTAATTTATTTATTTTTTTATTATTATTAAATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8877
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029175 Nonsense 691 895 27 32
Genomic Location (Zv9):
Chromosome 8 (position 20602731)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20032628
GRCz11 8 20064713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCCAACCCCAATGCACCAGTGTTAAGCTTCAGACTGGTGAACATCTCT[C/T]GAGTCGACCACTTCTTACCCAACCAGAAGCTACTCTACAGGTCCAGTATA
Associated Phenotype:
Not determined