Busch Lab

ZMP

klf12a

Ensembl ID:
ENSDARG00000015312
ZFIN ID:
ZDB-GENE-030131-9188
Description:
Kruppel-like factor 12 [Source:RefSeq peptide;Acc:NP_996945]
Human Orthologue:
KLF12
Human Description:
Kruppel-like factor 12 [Source:HGNC Symbol;Acc:6346]
Mouse Orthologue:
Klf12
Mouse Description:
Kruppel-like factor 12 Gene [Source:MGI Symbol;Acc:MGI:1333796]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa868 Essential Splice Site Confirmed mutation in F2 line Not yet available
sa32708 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa868
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012873 Essential Splice Site 211 373 4 6
Genomic Location (Zv9):
Chromosome 1 (position 34178817)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33813568
GRCz11 1 34546136
KASP Assay ID:
554-0770.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGTGCGCACATATTGTAAATCAACTCCCCCTACCTTTTGTTTTTATTC[A/G]GTGATGCACCGAATGGCAGATGGACTGTCACCGCGACGATCTCTGAGYGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012873 Nonsense 346 373 6 6
Genomic Location (Zv9):
Chromosome 1 (position 34188192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33822943
GRCz11 1 34555511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACTGACGCGACATTACCGCAAACACACCGGCGTCAAACCGTTCAAATG[C/A]AGCGACTGTGACCGCAGTTTCTCCCGCTCGGACCACCTTGCCCTCCACCG
Associated Phenotype:
Not determined