Busch Lab

ZMP

fzr1

Ensembl ID:
ENSDARG00000015254
ZFIN ID:
ZDB-GENE-040426-712
Description:
fizzy-related protein homolog [Source:RefSeq peptide;Acc:NP_956547]
Human Orthologue:
FZR1
Human Description:
fizzy/cell division cycle 20 related 1 (Drosophila) [Source:HGNC Symbol;Acc:24824]
Mouse Orthologue:
Fzr1
Mouse Description:
fizzy/cell division cycle 20 related 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1926790]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25392 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa21265 Nonsense Available for shipment Available now
sa34376 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25392
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 None None 495 None 14
ENSDART00000146989 Splice Site, Nonsense 5 109 2 5
Genomic Location (Zv9):
Chromosome 8 (position 21401865)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20831762
GRCz11 8 20863847
KASP Assay ID:
554-7525.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGACTTACACCCTTCTGCCTCGTTAATCAGCAAACAAATGACCATACTT[C/T]AAGTGTAGACCTTTAACTATTCATGTACATCATCATGACCTTCTAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 Nonsense 9 495 2 14
ENSDART00000146989 Nonsense 30 109 3 5
Genomic Location (Zv9):
Chromosome 8 (position 21402029)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20831926
GRCz11 8 20864011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCCATATTTTAGAATAACATCCATGGATCAGGACTATGAGCGCCGGT[T/G]ACTGCGGCAGATCAACGTCCAAAATGACAACACCAGCCCTATGGTTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015891 Nonsense 54 495 3 14
ENSDART00000146989 Nonsense 75 109 4 5
Genomic Location (Zv9):
Chromosome 8 (position 21403618)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20833515
GRCz11 8 20865600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCACCATTGTCATCGCCAAGCAAACATGGGGACAGATTTATACCATCC[C/T]GAGCTGGGGCCAACTGGAGCATCAATTTCCACAGAATAAATGTAGGTGGA
Associated Phenotype:
Not determined