Busch Lab

ZMP

cdkl5

Ensembl ID:
ENSDARG00000015240
ZFIN IDs:
ZDB-GENE-081022-110, ZDB-GENE-081022-110
Description:
cyclin-dependent kinase-like 5 isoform 1 [Source:RefSeq peptide;Acc:NP_001139240]
Human Orthologue:
CDKL5
Human Description:
cyclin-dependent kinase-like 5 [Source:HGNC Symbol;Acc:11411]
Mouse Orthologue:
Cdkl5
Mouse Description:
cyclin-dependent kinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1278336]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa24892 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35110 Nonsense Mutation detected in F1 DNA Not yet available
sa21938 Nonsense Available for shipment Available now
sa16950 Essential Splice Site Available for shipment Available now
sa35111 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24892
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 276 1039 10 17
ENSDART00000127502 Essential Splice Site 276 1080 10 18
Genomic Location (Zv9):
Chromosome 11 (position 31091768)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29969130
GRCz11 11 30216314
KASP Assay ID:
554-7656.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGTTCTACTGTGGCACGACTCTCCTCAATGCGTTTTTTACTGCACCA[G/A]AACCTGCTGTGCCTGAACCCTACCGAACGCTTTCTGACAGAGCAGTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35110
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 491 1039 11 17
ENSDART00000127502 Nonsense 491 1080 11 18
Genomic Location (Zv9):
Chromosome 11 (position 31094570)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29971932
GRCz11 11 30219116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGTCCTCACACGGATCCATGCCTTCCACGTCCTCCTCCAAAAGCTCCT[C/A]ATCCTTCCTCAGCTTGTCCAAAAGCCACGGCGCACTTAATGACGCCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21938
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 528 1039 11 17
ENSDART00000127502 Nonsense 528 1080 11 18
Genomic Location (Zv9):
Chromosome 11 (position 31094681)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29972043
GRCz11 11 30219227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTAGCAGAGACACGACTCCACCTGGATGATCCTATGGCAGGATCCGGTT[C/A]AGGCTCTCGATATTTCCCGTCCAGCTGCCTGGATCTAAACGCAGCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16950
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Essential Splice Site 730 1039 12 17
ENSDART00000127502 Essential Splice Site 730 1080 12 18
Genomic Location (Zv9):
Chromosome 11 (position 31095672)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29973034
GRCz11 11 30220218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGACKAGGGACAACACAGCTACCTTCCACACACAACGCCCAAAAAACGAG[G/A]TCCGAGGTCTCAGCAGGACCCTCAGAAMGCGTCCACTCAYACACTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35111
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010026 Nonsense 770 1039 14 17
ENSDART00000127502 Nonsense 770 1080 14 18
Genomic Location (Zv9):
Chromosome 11 (position 31098361)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29975723
GRCz11 11 30222907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTTCATTCAGGGATGTATTTGTTGTTTTTTTGTGTAGTCCCATCTCCT[C/T]GACCTGACAACACGTTTCTTGAGACCACTGGACAGAGCAGAGTGCAAGCG
Associated Phenotype:
Not determined