Busch Lab

ZMP

cd2apl

Ensembl ID:
ENSDARG00000015224
ZFIN ID:
ZDB-GENE-030131-8078
Description:
CD2-associated protein [Source:RefSeq peptide;Acc:NP_001008583]
Human Orthologue:
CD2AP
Human Description:
CD2-associated protein [Source:HGNC Symbol;Acc:14258]
Mouse Orthologue:
Cd2ap
Mouse Description:
CD2-associated protein Gene [Source:MGI Symbol;Acc:MGI:1330281]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa23766 Essential Splice Site Available for shipment Available now
sa10969 Essential Splice Site Available for shipment Available now
sa23767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23766
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102611 Essential Splice Site 2 657 None 19
ENSDART00000142932 Essential Splice Site 2 360 None 10
Genomic Location (Zv9):
Chromosome 20 (position 35882252)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35954765
GRCz11 20 35857644
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTGTACACATCAGATCAAGACGGTCTCGTATCGAAGGACAGTATGGG[T/C]GAGTTTAACTTGCTTCCTATGGGTCACCTAAAATGTCACTCAGCGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10969
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102611 Essential Splice Site 252 657 6 19
ENSDART00000142932 Essential Splice Site 252 360 6 10
Genomic Location (Zv9):
Chromosome 20 (position 35956873)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36029386
GRCz11 20 35932265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAACCTCCCTAAAAGGACCATCTGAAAATATGGAAAAAACAGAAAAAG[T/A]AAGTTGTTTTGCACCTGRCAATGCTTTTATTAGCTYTTTCTTTCNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23767
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102611 Nonsense 620 657 17 19
ENSDART00000142932 None None 360 None 10
Genomic Location (Zv9):
Chromosome 20 (position 35997198)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36069711
GRCz11 20 35972590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAAGGATCAGATAAAGGACCTGGTGCTCTCTGTAGAATTACTGAAGACA[C/T]AGCAGTCGTAAGTGGCAGCTTTTTCCATGAGTTTGTTTTTCCTGATATTT
Associated Phenotype:
Not determined