Busch Lab

ZMP

rbb4l

Ensembl ID:
ENSDARG00000015208
ZFIN ID:
ZDB-GENE-030131-848
Description:
Histone-binding protein RBBP7 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTY4]
Human Orthologue:
RBBP4
Human Description:
retinoblastoma binding protein 4 [Source:HGNC Symbol;Acc:9887]
Mouse Orthologue:
Rbbp4
Mouse Description:
retinoblastoma binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1194912]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10742 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27744
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008144 Nonsense 7 448 2 13
ENSDART00000081335 Nonsense 7 425 2 12
ENSDART00000131059 Nonsense 7 426 2 13
ENSDART00000142481 Nonsense 7 426 2 12

The following transcripts of ENSDARG00000015208 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 12809411)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12693820
GRCz11 11 12751479
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGATTTTTAATTAACAAATTATTATTTTTTTGCCTCCATCACAGTGTA[C/A]GATGACGCCGTGGAGGAGAGGGTAATAAATGAGGAGTACAAGATCTGGAA
Long Flanking Sequence:
TTATAAGTTGATGTATTGATTATTGTGAAAGGCCTAAATGTCACATGATGTTTGTAAATCACACCTATGGAAAAGTGCAGTTCGTTATGTGTCTATGACAGCTCGAGGTATCACAAACTGAATGCAAATATAATGCTATTTAATGTAAAAAAGTGAAAATGTCCTCCTATCCGGCCAAATTTTGCAGGAAATCTGCAGCAATTAAAATAATTACAAACTCCTCTAAATTTAGCACCACATCCTTGGCTTGGCGTTAAAAACAGATTGCAAAATTCTGGAGGTACTTTTCAACTCAACAGCTGCCTGATTTTGTTCAGTATAGGTCAAGGAAATTAAATTTTTTTGTCAGTCAAAGTCATGGAGAAGTAATTTGAATTTTGGCTTCCACAGTGTTAATCACTTTCAATTGCATTCATTTGTTAGGAAAAGTGCTGTATACATATAAATTGTATTGATTTTTAATTAACAAATTATTATTTTTTTGCCTCCATCACAGTGTA[C/A]GATGACGCCGTGGAGGAGAGGGTAATAAATGAGGAGTACAAGATCTGGAAGAAAAACACACCATTCCTGTATGACCTAGTCATGACACATGCGCTCGAGTGGCCAAGTTTAACAGTGCAGTGGCTTCCTGATGTCAACAGGTAATCCACTGGCTAACTTGTGTATGTTTTAAAACAGAGCAGTTGATCAAGACACTAAGTATGACTGTCCGTTTTTATACAGGCCTGAGGGGAAGGACTATGTGGTTCACCGGCTGGTGTTGGGCACACACACTTCAGACGAGCAAAACCATCTGGTCATCGCCAGTGTTCAGATCCCCAATGATGACGCTCAGTTCGACGCTTCCCACTATGACAGTGAGAAAGGAGGTAAGAGCTGATCTGAGCATGAATGGATGCTAATTTAGTTTTATTGTGTTGAAGTCATTAGAATAACATCAATTTTGTCTTTGTGTTTCTTCAGCAGGTATGGTCAGGATGTTGAGAGGAAATCCAGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10742
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008144 Nonsense 75 448 3 13
ENSDART00000081335 Nonsense 75 425 3 12
ENSDART00000131059 Nonsense 75 426 3 13
ENSDART00000142481 Nonsense 75 426 3 12

The following transcripts of ENSDARG00000015208 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 12809695)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12694104
GRCz11 11 12751763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGACTATGTGGTTCACCGGCTGGTGTTGGGCACACACACTTCAGAYGAG[C/T]AAAACCATCTGGTCATCGCCAGTGTTCAGATCCCCAATGATGACGCTCAG
Long Flanking Sequence:
TTTTCAACTCAACAGCTGCCTGATTTTGTTCAGTATAGGTCAAGGAAATTAAATTTTTTTGTCAGTCAAAGTCATGGAGAAGTAATTTGAATTTTGGCTTCCACAGTGTTAATCACTTTCAATTGCATTCATTTGTTAGGAAAAGTGCTGTATACATATAAATTGTATTGATTTTTAATTAACAAATTATTATTTTTTTGCCTCCATCACAGTGTACGATGACGCCGTGGAGGAGAGGGTAATAAATGAGGAGTACAAGATCTGGAAGAAAAACACACCATTCCTGTATGACCTAGTCATGACACATGCGCTCGAGTGGCCAAGTTTAACAGTGCAGTGGCTTCCTGATGTCAACAGGTAATCCACTGGCTAACTTGTGTATGTTTTAAAACAGAGCAGTTGATCAAGACACTAAGTATGACTGTCCGTTTTTATACAGGCCTGAGGGGAAGGACTATGTGGTTCACCGGCTGGTGTTGGGCACACACACTTCAGACGAG[C/T]AAAACCATCTGGTCATCGCCAGTGTTCAGATCCCCAATGATGACGCTCAGTTCGACGCTTCCCACTATGACAGTGAGAAAGGAGGTAAGAGCTGATCTGAGCATGAATGGATGCTAATTTAGTTTTATTGTGTTGAAGTCATTAGAATAACATCAATTTTGTCTTTGTGTTTCTTCAGCAGGTATGGTCAGGATGTTGAGAGGAAATCCAGATTCATTTGATCAATAAGAGTGAATCATTCCACAAAGATGTTACAGCTGCATGTGTTTTCGACAGCTATGTTTTGTTTATATCTGTATTAAATGTATATAACCATATACTGGTGTTCTAGGAATAGTCAAATGAAAAATTACAATTCTGTTGTCATTTACTCATCTTGAAAATGTGACTGATGTGCATGTATTTTTGTTTACTAACTATTTCAGAGTTTGGAGGGTTTGGATCAGTTAGTGGAAAGATTGAGATTGAGATTAAGATCAACCATGAAGGAGAAGTGAACA
Associated Phenotype:
Not determined