Busch Lab

ZMP

abcd3a

Ensembl ID:
ENSDARG00000015167
ZFIN ID:
ZDB-GENE-040426-2868
Description:
ATP-binding cassette sub-family D member 3 [Source:RefSeq peptide;Acc:NP_998647]
Human Orthologue:
ABCD3
Human Description:
ATP-binding cassette, sub-family D (ALD), member 3 [Source:HGNC Symbol;Acc:67]
Mouse Orthologue:
Abcd3
Mouse Description:
ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17682 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17682
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019318 Essential Splice Site 438 656 15 23

The following transcripts of ENSDARG00000015167 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31225641)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31381963
GRCz11 24 31319174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGGTGCCTGGAAGTGGAAGAATCATCAACATAGACAATATCRTCAAG[T/C]AAGAGTGGCTTCTCTCTGTCGCTGTATTTCAGTTTGGTGAACTATTTAWA
Long Flanking Sequence:
GTGAGCCCTGGGCTTGATATCAAATATCGATGTGTTTTTAACAGGACTACTATCAGAGCGGCCGTATGTTGTTGCGGATGTCGCAGGCATTGGGCAGAATCGTGCTTGCAGGCAGAGAAATGACGCGTCTATCAGGGTAAAAGTTCACACTTCTCATCATTGTGCACCAGCATGTGTTATTAACTTGTCTGGTTGCTTGCCATTTCATTAAAATAAGACAGTTTGATGGTGTGAAATGAGTTTGTCTTTGGCTTCAGCTTCACAGCTCGCATCACTGAGCTCATGAGAGTCCTGAAAGAGCTGAACTCTGGTAAATACGAACGCACCATGGTGTCCCAGTCAGAGAAAGGTGAGCTTCTGACACTTCTAAAATCTAAAATAATGCTATGTAGTTGATCTTTTTAATAGTTCGTTTGTATTTTTGGTGATCAGATGCTTCAGAAAAGCTCACACTGGTGCCTGGAAGTGGAAGAATCATCAACATAGACAATATCATCAAG[T/C]AAGAGTGGCTTCTCTCTGTCGCTGTATTTCAGTTTGGTGAACTATTTATACTAATTTTAACATTTGATTTCCCCTCAGGTTCGATCACACACCTCTGGCTACTCCTAATGGAGATGTTCTGATCAGAGATCTGTGTTTTGAGGTGTGTTAAACTTTGATTTTTATCATGTTTGATTTTATGTTTCGTTTCTTTTCTTGGACGCATAAGGATGTAATTCTGCCCCTAATAACTGCTTTTAAGGTGTCCCATAATATAATATATCCTGAGTTGACTTCTTCATTATCATTTTCTGTAAGAAATAATTCTATGTCCTCCTTAATTTGAGTTTGAAATTGTTTAGCATGCTTGTATTTAGTCTCCACAGTGTTCTTCCTCTGTTATCTCTAAAATACAGTTGAAGTAAGAATTATTAGCCCCCCTGAATTATTAGTGCATCTGTTTATTTTTTGGGTGGTGGTTTGGTGATGGTAGACTATCGAAAAAAACTAAATCCCTTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19344
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019318 Essential Splice Site 577 656 20 23

The following transcripts of ENSDARG00000015167 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31229380)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31378224
GRCz11 24 31315435
KASP Assay ID:
554-7084.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGACTGGATGGATGTGCTCAGTGGAGGAGAGAAGCAGAGAATGGCGG[T/G]AAATTAAGACTTTTTCCAACCACAAACAGTAATGTAAATTGACTTTCAGT
Long Flanking Sequence:
GCCCTGTGAAAATTCCTCCCTTTAGCAAGCTTAAATGTTGGTTTTTCGTCTCTCTGTAGTTGTGGCCACTGTTTGGTGGGAATCTGACGAAACCAGAGAGAGGGAAGCTCTTCTACGTCCCTCAGGTGAAACAAAACCCACAGAAGAGCATCTGAATAGTCCCCAACAGCCAAATAACTGCCCTTTTTGTCTGTTTCCAGAGGCCTTACATGACTCTCGGTTCGCTGAGGGATCAAGTGATCTATCCAGACACCCATGAGAGTCAAAAGAAGAAAGGCATCTCTGACCTGGTGCTGTAAACTGTTTTAAAATCTCTAACCTGTTGGGGTTTTATTTTAGTTTGTAGTTTTTTAATCCATCTATCTATTTTTTGTGTCAGGTGCTAAAGGAGTATCTGGATAATGTCCAGTTAGGACACATTTTGGACAGAGAGGGTTCATGGGATACAGTTCAGGACTGGATGGATGTGCTCAGTGGAGGAGAGAAGCAGAGAATGGCGG[T/G]AAATTAAGACTTTTTCCAACCACAAACAGTAATGTAAATTGACTTTCAGTAACTGGGTAGAGGGATCTCATGGGATGAACAGAATCAGAGGCACAACACTGATAAGAGCTGCTTTTGTTGTGTAGTTAACATCCTGTTTTTGCAACACTTCACCACAGTTTATTCAACACTGTTACACTTTTGCGATTAAAATCTTGAATCAATGTTTTTTTTTTTACAAAGTAAGGATTAAGAGGTTGTGTTCTCGCTATTTGTTTTACATAATTCTCCTGTCTCCAATACTGGGTTGCGGCTGGAAGGGCATTCACTGTGTAAAACATATGCTGTAATAGTTGGCAGTTCATTCTGCTGTGGCGACTTCTGATAATTCAGAGACTAAGCCAAAGGAAAATGAATGAATGAAGGATTTATACTCTTGTTATATGATGTTAAAGAAGGCAGGTGTATTATTTTTATAGGTGGGCATAGATTCATTTTTAATCTAGATTAATTTCACTGTA
Associated Phenotype:
Not determined