Busch Lab

ZMP

wasa

Ensembl ID:
ENSDARG00000015149
ZFIN ID:
ZDB-GENE-081104-419
Description:
Novel protein similar to H.sapiens WASL, Wiskott-Aldrich syndrome-like (WASL) [Source:UniProtKB/TrEM
Human Orthologue:
WAS
Human Description:
Wiskott-Aldrich syndrome (eczema-thrombocytopenia) [Source:HGNC Symbol;Acc:12731]
Mouse Orthologue:
Was
Mouse Description:
Wiskott-Aldrich syndrome homolog (human) Gene [Source:MGI Symbol;Acc:MGI:105059]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34409 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34409
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026807 Nonsense 59 630 2 11
ENSDART00000140152 Nonsense 59 442 2 9
ENSDART00000141431 None None 159 None 3

The following transcripts of ENSDARG00000015149 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26488006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25615924
GRCz11 8 25635063
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTGCTTATGGCTCTTCCGAGCGACCCGAATCGATGGACACCACAA[C/T]AATCTGGAGTTGTTTGTTTCGTCAAGGACAGTTCTCTGCGCTCCTTTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3696
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026807 Nonsense 147 630 5 11
ENSDART00000140152 Nonsense 147 442 5 9
ENSDART00000141431 None None 159 None 3

The following transcripts of ENSDARG00000015149 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26492923)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25620841
GRCz11 8 25639980
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTAACTAGGCGTGTCWGTGAATGTTTTCTTTTATATTAAGCGGAGAAA[C/T]AGCAGAGAAAAGGATCAGAAACAAGAGGTAAGACACTGTCAGTTSTCATA
Associated Phenotype:
Not determined