Busch Lab

ZMP

slc18a2

Ensembl ID:
ENSDARG00000015110
ZFIN ID:
ZDB-GENE-080514-1
Description:
Slc18a2 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZP4]
Human Orthologue:
SLC18A2
Human Description:
solute carrier family 18 (vesicular monoamine), member 2 [Source:HGNC Symbol;Acc:10935]
Mouse Orthologue:
Slc18a2
Mouse Description:
solute carrier family 18 (vesicular monoamine), member 2 Gene [Source:MGI Symbol;Acc:MGI:106677]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa36403 Nonsense Mutation detected in F1 DNA Not yet available
sa36404 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6475 Nonsense Mutation detected in F1 DNA Not yet available
sa12325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36403
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 130 561 3 16
Genomic Location (Zv9):
Chromosome 17 (position 23614392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23764541
GRCz11 17 23784565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACCCCTCTTTCTCCATCGAGCACCTTTCAGAGCATTGTGTCTTTGTA[T/A]GACAACACCACACGTGTGACAGGCTTCAGCCCGCAGATGAGCACAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36404
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Essential Splice Site 222 561 4 16
Genomic Location (Zv9):
Chromosome 17 (position 23615580)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23765729
GRCz11 17 23785753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCCCAATGTTTGCTGGTTTCTGCATCATGTTTGTTTCTACGATCAG[T/C]GAGTACATAAAACATATATATTTTTAATGCTGCTTTTAACATTAATCTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4713
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 258 561 6 16
Genomic Location (Zv9):
Chromosome 17 (position 23618882)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23769031
GRCz11 17 23789055
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCTGTCTGTTTATTATTGTGTAGGTATGGGGATGCTGGCAAGTGTTTA[C/A]ACAGATGACGAGGAACGAGGAAACGCTATTGGGATTGCACTGGGAGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6475
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 264 561 6 16
Genomic Location (Zv9):
Chromosome 17 (position 23618898)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23769047
GRCz11 17 23789071
KASP Assay ID:
554-5475.1 (used for ordering genotyping assays)
KASP Sequence:
ATTGTGTAGGTATGGGGATGCTGGCAAGTGTTTAHACAGATGACGAGGAA[C/T]GAGGAAACGCTATTGGGATTGCACTGGGAGGACTAGCAATGGGAGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025466 Nonsense 514 561 15 16
Genomic Location (Zv9):
Chromosome 17 (position 23633732)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23783881
GRCz11 17 23803905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCTCATGACCATCATCGGTTTAGTGGACATCAKGTTTGCTCCTCTTTG[T/A]TTCTTTCTGCGAAATCCTCCCGCCAACGAGGAAAAGATGGTTAGAATYCA
Associated Phenotype:
Not determined