Busch Lab

ZMP

dmrt2a

Ensembl ID:
ENSDARG00000015072
ZFIN ID:
ZDB-GENE-990621-7
Description:
doublesex- and mab-3-related transcription factor 2 [Source:RefSeq peptide;Acc:NP_571027]
Human Orthologue:
DMRT2
Human Description:
doublesex and mab-3 related transcription factor 2 [Source:HGNC Symbol;Acc:2935]
Mouse Orthologue:
Dmrt2
Mouse Description:
doublesex and mab-3 related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1330307]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33689 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40541 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33689
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010786 Essential Splice Site 148 507 3 4
Genomic Location (Zv9):
Chromosome 5 (position 46627874)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44409139
GRCz11 5 45009292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCGACACATCCGCCCATCGACCATGCTGGCAAAAAGCATTTTAGAAGG[T/G]GGGTAAAAACAACAACAACAACAACAAAAAAACAAATTCTGTAGCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40541
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010786 Nonsense 457 507 4 4
Genomic Location (Zv9):
Chromosome 5 (position 46629227)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 44410492
GRCz11 5 45010645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAGGAGCTGCTGGAGGAAGCGGCGAAAAAGTTCAGGGAAGGTACAGCC[A/T]AAGACACAGTGGGACTCAAAAGCTCGGAAAGAGCGGCAAAGGACTTTGTA
Associated Phenotype:
Not determined