Busch Lab

ZMP

slc23a1

Ensembl ID:
ENSDARG00000015033
ZFIN ID:
ZDB-GENE-080804-2
Description:
solute carrier family 23 member 1 [Source:RefSeq peptide;Acc:NP_001166970]
Human Orthologue:
SLC23A1
Human Description:
solute carrier family 23 (nucleobase transporters), member 1 [Source:HGNC Symbol;Acc:10974]
Mouse Orthologue:
Slc23a1
Mouse Description:
solute carrier family 23 (nucleobase transporters), member 1 Gene [Source:MGI Symbol;Acc:MGI:1341903

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30723 Nonsense Mutation detected in F1 DNA Not yet available
sa23969 Nonsense Available for shipment Available now
sa16168 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Nonsense 73 635 2 14
Genomic Location (Zv9):
Chromosome 21 (position 28849154)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30068398
GRCz11 21 30105093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGCATCTTTTGATATGATCTACAGGATCGAGGACGTCCCGCCTTGGTA[T/A]CTGTGTATCCTGCTGGGACTGCAGGTTTACACTTATTTTCTCTTCTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23969
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Nonsense 281 635 7 14
Genomic Location (Zv9):
Chromosome 21 (position 28842112)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30061356
GRCz11 21 30098051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCTCTCCCAAGCTTTTCTAAAGAAAAAGGCTGTCATATAACCCACGTC[C/T]AAATTTTCAAGATGTTTCCGGTATGAACCAATATTCAACGCTCAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16168
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014223 Essential Splice Site 547 635 13 14
Genomic Location (Zv9):
Chromosome 21 (position 28836325)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30055569
GRCz11 21 30092264
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATGTTTGTTGGGGGATTCTTAGCATTTGTACTWGACAACACAATCCCAG[G/A]TATAACCGTGGACTTWTYCTTCAGATAATAAGMCAAYAAAGACAATTCAT
Associated Phenotype:
Not determined