Busch Lab

ZMP

zgc:112257

Ensembl ID:
ENSDARG00000014976
ZFIN ID:
ZDB-GENE-050522-56
Description:
hypothetical protein LOC553696 [Source:RefSeq peptide;Acc:NP_001018506]
Human Orthologues:
AC108938.4, LIMS1, LIMS3
Human Descriptions:
LIM and senescent cell antigen-like domains 1 [Source:HGNC Symbol;Acc:6616]
LIM and senescent cell antigen-like domains 3 [Source:HGNC Symbol;Acc:30047]
LIM and senescent cell antigen-like-containing domain protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9H
Mouse Orthologue:
Lims1
Mouse Description:
LIM and senescent cell antigen-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1195263]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44697 Nonsense Mutation detected in F1 DNA Not yet available
sa34535 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44697
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006099 Nonsense 257 377 6 11
ENSDART00000147882 Nonsense 213 333 5 10
Genomic Location (Zv9):
Chromosome 9 (position 426946)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 119278
GRCz11 9 97847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAGGAGACCAGTGGAGGGACGAGTGGTCAACGCCATGGGGAAACAGT[G/A]GCACGTGGAGGTACACACACACACACACACGCACACGCACGCACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006099 Essential Splice Site 307 377 8 11
ENSDART00000147882 Essential Splice Site 263 333 7 10
Genomic Location (Zv9):
Chromosome 9 (position 426545)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 118877
GRCz11 9 97446
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTTCGGGGACGTCTGCTTTCAGTGTAACCGTGTGATCGAGGGTGACG[G/A]TGAGTTGCATTTACACTGAGTGTGTGTGTGTGTGTGTACCTGCTGACACT
Associated Phenotype:
Not determined