Busch Lab

ZMP

si:ch211-223f21.1

Ensembl ID:
ENSDARG00000014973
ZFIN ID:
ZDB-GENE-091118-13
Human Orthologue:
NTNG1
Human Description:
netrin G1 [Source:HGNC Symbol;Acc:23319]
Mouse Orthologue:
Ntng1
Mouse Description:
netrin G1 Gene [Source:MGI Symbol;Acc:MGI:1934028]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11034 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11034
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105743 Nonsense 85 465 1 7
ENSDART00000145816 Nonsense 41 353 1 4

The following transcripts of ENSDARG00000014973 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 30376617)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29372378
GRCz10 24 29461948
GRCz11 24 29450009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGAGTCAGGTCGGCCGGAGCAGATGGTTTTAGAGAAGTCTCTGGACTA[T/A]GGACGTAGCTGGCAGCCCTACCAGYTCTATGCTACCGACTGCCTCGACGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4270
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105743 Essential Splice Site 283 465 3 7
ENSDART00000145816 None None 353 None 4

The following transcripts of ENSDARG00000014973 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 30419932)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29505263
GRCz11 24 29493324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTGTGGATGGAGCGACGTGTGCCTCCTGGCAGCTGTTGTACCTCAA[G/A]TCTGTAGGAGCCGGTGGAGTGTTTTAAAGGACTGAGATTGACAGGACATT
Associated Phenotype:
Not determined