Busch Lab

ZMP

htra1b

Ensembl ID:
ENSDARG00000014907
ZFIN ID:
ZDB-GENE-080219-7
Description:
HtrA serine peptidase 1 [Source:RefSeq peptide;Acc:NP_001104652]
Human Orthologue:
HTRA1
Human Description:
HtrA serine peptidase 1 [Source:HGNC Symbol;Acc:9476]
Mouse Orthologue:
Htra1
Mouse Description:
HtrA serine peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1929076]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa12975 Nonsense Available for shipment Available now
sa27906 Nonsense Mutation detected in F1 DNA Not yet available
sa24904 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22048 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12975
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Nonsense 17 476 1 9
Genomic Location (Zv9):
Chromosome 12 (position 12563494)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11419147
GRCz11 12 11457450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGCGTCTTTTGATTCTGTGCGCGTCTATTATTCTGGTACCGCTGCTGTG[C/A]GATGCGCGGATCATTAAGCGTTATGTGATCGGCTGTCCGGAGCGCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Nonsense 151 476 1 9
Genomic Location (Zv9):
Chromosome 12 (position 12563092)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11418745
GRCz11 12 11457048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGCAGAAGCTTCAGCAGCCACCCATCATCTTCATCCAGAGAGGAGCCTG[C/A]GGGAAAGGTAAGAATTGACCTTTTACATTTCCAAGTTTTGACAAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24904
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Essential Splice Site 370 476 6 9
Genomic Location (Zv9):
Chromosome 12 (position 12507599)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11363252
GRCz11 12 11401555
KASP Assay ID:
554-7492.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAAGATCCGACAGTTCCTGGCTGAGTCTCACGACAGGCAGGCTAAAGG[T/G]CAGCAGCAGCATTTAAAACTTAGAAACATCTAAGTCCTGTTATGACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Essential Splice Site 389 476 8 9
Genomic Location (Zv9):
Chromosome 12 (position 12504142)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11359795
GRCz11 12 11398098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGCAAACAGACATGGCGTTTGTGTTTGTACTAAGAATCTGTTTCTCAT[A/T]GACTTGCTAAGGAGCTAAAGCAGAGAAAAAATGATTTCCCAGATGTCACC
Associated Phenotype:
Not determined